We narrowed to 18,004 results for: URE
-
Plasmid#137725PurposeLentivirus reporter assay plasmid that contains a I-SceI site and a EGFP reporter gene.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pKD280.7
Plasmid#173172PurposeExpresses SO_4387DepositorInsertSO_4387
ExpressionBacterialPromoterJ23107Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD0009_CROP-seq-mCherry2
Plasmid#242529PurposeGeneral screeningDepositorInsertmCherry2
UseLentiviralAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLC-255
Plasmid#124292PurposeExpression of vsfGFP-9. This construct improves brightness of sfGFP by fusing a GFP-specific single domain antibody to it that creates a monomeric fluorophore.DepositorInsertvsfGFP-9
ExpressionBacterialAvailable SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
SIN-mGAD67-AcGFPnuc-WPRE
Plasmid#245086PurposeLentiviral vector with nuclear fluorescent reporter AcGFP expressed from Mouse GAD67 promoterDepositorInsertAcGFP
UseLentiviralTags3x SV40 NLSExpressionMammalianPromoterMouse GAD67 promoterAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
sortase A pentamutant (eSrtA) in pET29
Plasmid#75144Purposeevolved sortase A (eSrtA) pentamutant with improved kinetics and activityDepositorInsertsortase A pentamutant
Tags6x HisExpressionBacterialMutationP94R, D160N, D165A, K190E, K196T. Deleted amino a…PromoterT7Available SinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tn7 helper plasmid
Plasmid#141161PurposeTemperature-sensitive plasmid carries tnsABCD genes that encode transposase biochemical machinery under an arabinose-inducible pBAD promoterDepositorInsertTn7 transposon machinery
ExpressionBacterialPromoterArabinose-inducible pBADAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-21a(+)-AK1-His
Plasmid#118977PurposeBacterial expression plasmid for Adenylate kinase isoenzyme 1DepositorInsertadenylate kinase isoenzyme 1 AK1 (AK1 Chicken)
Tags6x-HisExpressionBacterialPromoterT7 promoterAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBR_attB(bxb)_lox
Plasmid#183762PurposeBxb1-specific donor plasmid for the cloning of payloads <20 kbDepositorTypeEmpty backboneUseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hDlx_DIO_ChR2_mCherry
Plasmid#224459PurposeAn AAV vector expressing ChR2-mCherry that is dependent on both Cre and the hDlx enhancerDepositorInsertChR2-mCherry
UseAAVExpressionMammalianAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hOCT4
Plasmid#17225DepositorAvailable SinceJan. 18, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCW57-GFP-2A-MCS
Plasmid#71783PurposeAll-in-one doxycycline inducible lentiviral vector for expression of one gene in combination with turbo GFP using the P2A self-cleaving peptide.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral; Doxycycline inducible; p2a self cleav…ExpressionMammalianAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
SadCas9 VPR
Plasmid#188514PurposeExpresses FLAG tagged SadCas9 VPRDepositorInsertdCas9
UseCRISPR and LentiviralExpressionMammalianMutationD10A/N580APromoterEF1aAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUCXMG
Plasmid#204409PurposeExpression plasmid for cloning of FatI digested metagenomic DNA into a compatible NcoI siteDepositorTypeEmpty backboneTagsHis6ExpressionBacterialPromotertacAvailable SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO-EGFP-G3BP1-WT
Plasmid#136003PurposeDOX-inducible WT G3BP1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex SystemDepositorAvailable SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-G3BP1-DeltaRBP
Plasmid#135999PurposeG3BP1 with RNA binding domains deleted inserted with GFP tagged on the N-terminusDepositorInsertG3BP1 (G3BP1 Human)
TagsEGFPExpressionMammalianMutationC-term of G3BP1 Deleted for Delta RBPAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-G3BP1-S149A
Plasmid#135998PurposeS149A G3BP1 inserted with GFP tagged on the N-terminus used to stably integrate into cellsDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only