We narrowed to 2,923 results for: COB;
-
Plasmid#60280PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pGL4.23 C2_10
Plasmid#60287PurposeThis plasmid contains a human pancreatic islet inactive enhancer, a minimal promoter and a luc2 gene.DepositorInsertLINGO2 inactive enhancer (LINGO2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C2_14
Plasmid#60290PurposeThis plasmid contains a human pancreatic islet inactive enhancer, a minimal promoter and a luc2 gene.DepositorInsertEDARADD inactive enhancer (EDARADD Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_5
Plasmid#60291PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertWSCD2 enhancer (WSCD2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_6
Plasmid#60292PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertGRM4 enhancer (GRM4 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_8
Plasmid#60294PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertKIRREL3 enhancer (KIRREL3 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_11
Plasmid#60297PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertCDKAL1 enhancer (CDKAL1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C2_10
Plasmid#60250PurposeThis plasmid contains a human pancreatic islet inactive enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C2_14
Plasmid#60253PurposeThis plasmid contains a human pancreatic islet inactive enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_5
Plasmid#60254PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pScaffold-H1 donor
Plasmid#118152PurposePCR template for dual guide RNA cloning, guide RNA scaffold for the Streptococcus pyogenes CRISPR/Cas9 system - H1 promoterDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
GCN5 core-dCas9-p300 core
Plasmid#179553Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human GCN5 core (aa 473-676) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
p300 core-dCas9-CBP core
Plasmid#179559Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human p300 core (aa 1048-1664) and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-T2A-HygR
Plasmid#118153PurposeSpCas9 expression vectorDepositorInserthSpCas9-T2A-HygR
UseCRISPRTags3XFLAGExpressionMammalianMutationPromoterCAG and U6Available SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-M1-di-Ub(G76V)-HOIL-1
Plasmid#229539PurposeConstitutively active M1-di-ubiquitin HOIL-1 fusion protein for expression in E. coliDepositorUseTags6xHis-3CExpressionBacterialMutationChanged Gly 76 to Val and changed Gly 76 to ValPromoterT7Available SinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
GCN5 core-dCas9-CBP core
Plasmid#179555Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human GCN5 core (aa 473-676) and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
GCN5 FL-dCas9-CBP core
Plasmid#179556Purposeencodes S. pyogenes dCas9 with n-terminal fusion of full length human GCN5 and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-CBP core
Plasmid#179560Purposeencodes S. pyogenes dCas9 with both n-terminal and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide4
Plasmid#125516PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
UseTagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CCLMPC_HA-NUP98
Plasmid#237482PurposeExpress HA-tagged NUP98 in dual promoter lentiviral vectorDepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-p300 core
Plasmid#179558Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human CBP core (aa 1084-1701) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
GCN5 FL-dCas9-p300 core
Plasmid#179554Purposeencodes S. pyogenes dCas9 with n-terminal fusion of full length human GCN5 and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide2
Plasmid#125514PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide1
Plasmid#125513PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide3
Plasmid#125515PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEH_AAV_TERT_prom_-124C>T_C7C_1.8kb
Plasmid#183080PurposerAAV transfer plasmid with ITRs flanking: (1) TERT -124C>T promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms, and (2) PGK-Puro.DepositorInsertTERT -124C>T promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms (TERT Human)
UseAAV; Homologous recombination donor templateTagsExpressionMutation-124C>T promoter, Exon 1 C7C (C21>T21) sile…PromoterNone for primary insert (Though partial TERT prom…Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEH_AAV_TERT_prom_-146C>T_C7C_1.8kb
Plasmid#183081PurposerAAV transfer plasmid with ITRs flanking: (1) TERT -146C>T promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms, and (2) PGK-Puro.DepositorInsertTERT -146C>T promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms (TERT Human)
UseAAV; Homologous recombination donor templateTagsExpressionMutation-146C>T promoter, Exon 1 C7C (C21>T21) sile…PromoterNone for primary insert (Though partial TERT prom…Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR
Plasmid#118155PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-BlastR under the hPGK promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterhPGK and U6Available SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEH_AAV_TERT_prom_C7C_1.8kb
Plasmid#183079PurposerAAV transfer plasmid with ITRs flanking: (1) TERT wildtype promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms, and (2) PGK-Puro.DepositorInsertTERT wildtype promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms (TERT Human)
UseAAV; Homologous recombination donor templateTagsExpressionMutationWildtype promoter, Exon 1 C7C (C21>T21) silent…PromoterNone for primary insert (Though partial TERT prom…Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 OPTN TSS-guide4
Plasmid#118199PurposeCRISPR-mediated activation of OPTN. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide1
Plasmid#118166PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA1 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZBED3-TSS-guide1
Plasmid#125506PurposeCRISPR-mediated activation of ZBED3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 CRY2-TSS-guide3
Plasmid#125491PurposeCRISPR-mediated activation of CRY2. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 CRY2-TSS-guide2
Plasmid#125490PurposeCRISPR-mediated activation of CRY2. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 TCF7L2 TSS-guide1
Plasmid#118184PurposeCRISPR-mediated activation of TCF7L2. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 TCF7L2 TSS-guide4
Plasmid#118187PurposeCRISPR-mediated activation of TCF7L2. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 TCF7L2 TSS-guide3
Plasmid#118186PurposeCRISPR-mediated activation of TCF7L2. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide2
Plasmid#118167PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA2 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 C2CD4B-TSS-guide4
Plasmid#125485PurposeCRISPR-mediated activation of C2CD4B. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 C2CD4A-TSS-guide2
Plasmid#125481PurposeCRISPR-mediated activation of C2CD4A. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 VPS13C-TSS-guide2
Plasmid#125477PurposeCRISPR-mediated activation of VPS13C. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 C2CD4A/B-enh3-guide3
Plasmid#125475PurposeCRISPR-mediated activation of human islet enhancer containing T2D-associated variant rs17205526 (C2CD4A/B GWAS locus)DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 C2CD4A/B-enh2-guide2
Plasmid#125470PurposeCRISPR-mediated activation of human islet enhancer containing T2D-associated variant rs7163757 (C2CD4A/B GWAS locus)DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 C2CD4A/B-enh1-guide3
Plasmid#125467PurposeCRISPR-mediated activation of human islet enhancer containing T2D-associated variant rs182222907 (C2CD4A/B GWAS locus)DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCamKII-Cre-pU6-SpCas9gRNAentry
Plasmid#210391PurposeAAV plasmid encoding the CamKII promoter driving Cre expression, along with SpCas9 gRNA entry cassette (RFP dropout)DepositorInsertAAV-(ITR)-pCamKII-NLS-Cre-WPRE-bGHpA-(rev)-SpCas9_gRNA-BsmBI_RFPcassette-hU6-(ITR) (NJA158)
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterCamKII promoter for Cre, human U6 promoter for Sp…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_MSCV-NUP98-ires-GFP
Plasmid#237481PurposeExpress NUP98 in bicistronic retroviral vectorDepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEH_AAV_BRAF_ex15_V600E_S607S_1.8kb
Plasmid#183078PurposerAAV transfer plasmid with ITRs flanking: (1) BRAF V600E (T>A), S607S (TCC>AGT), 1.8kb homologous recombination donor template centered on BRAF exon 15 with ~900 bp homology arms, and (2) PGK-Puro.DepositorInsertBRAF Exon 15, 1.8kb homologous recombination donor, ~900 bp homology arms (BRAF Human)
UseAAV; Homologous recombination donor templateTagsExpressionMutationV600E (T>A), S607S (TCC>AGT)PromoterNone for primary insert. PGK for puromycin resist…Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 rs58692659-guide4
Plasmid#125512PurposeCRISPR-mediated activation of human islet enhancer containing T2D-associated variant rs58692659 (ZFAND3 GWAS locus)DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 rs58692659-guide3
Plasmid#125511PurposeCRISPR-mediated activation of human islet enhancer containing T2D-associated variant rs58692659 (ZFAND3 GWAS locus)DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only