We narrowed to 9,707 results for: crispr plasmids
-
Plasmid#244239PurposeExpresses SpCas9 and a sgRNA targeting the human histone H3.2 loci for knock-in.DepositorUseCRISPRExpressionMammalianPromoterU6Available SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-U6-DR30(SapI)-CMV-intron-MCS-pA
Plasmid#192496PurposeTo express CasRX gRNA and contains MCS to insert coding region of interestDepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV-NLS-SaCas9-NLS-3xHA-bGHpA;U6-Cre-2
Plasmid#237891PurposeCre-KO AAV vector#2 containing SaCas9 and its sgRNA targeting CreDepositorInsertsgRNA-Cre
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV-NLS-SaCas9-NLS-3xHA-bGHpA;U6-Cre-3
Plasmid#237892PurposeCre-KO AAV vector#3 containing SaCas9 and its sgRNA targeting CreDepositorInsertsgRNA-Cre
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Non-Targeting
Plasmid#241026PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of a non-targeting sgRNA; used as control for SaCas9 based knock-outs in murine astrocytesDepositorInsertU6 driven empty sgRNA
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hEGFR_2b)-PGKpuro2ABFP-W
Plasmid#208432PurposeLentiviral gRNA plasmid targeting human EGFR gene, co-expression of BFP tagDepositorInsertEGFR (EGFR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hRNF31_2b)-PGKpuro2ABFP-W
Plasmid#208415PurposeLentiviral gRNA plasmid targeting human RNF31 gene, co-expression of BFP tagDepositorInsertRNF31 (RNF31 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hXIAP_1k)-PGKpuro2ABFP-W
Plasmid#208420PurposeLentiviral gRNA plasmid targeting human XIAP gene, co-expression of BFP tagDepositorInsertXIAP (XIAP Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hXIAP_2b)-PGKpuro2ABFP-W
Plasmid#208421PurposeLentiviral gRNA plasmid targeting human XIAP gene, co-expression of BFP tagDepositorInsertXIAP (XIAP Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hEGFR_1k)-PGKpuro2ABFP-W
Plasmid#208431PurposeLentiviral gRNA plasmid targeting human EGFR gene, co-expression of BFP tagDepositorInsertEGFR (EGFR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hRNF31_1k)-PGKpuro2ABFP-W
Plasmid#208414PurposeLentiviral gRNA plasmid targeting human RNF31 gene, co-expression of BFP tagDepositorInsertRNF31 (RNF31 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DjCas13d-P2A-mCherry-pA
Plasmid#233027PurposeTo Express HA tagged DjCas13d and mcherry from the mammalian EFS promoter. The DjCas13dx and mCherry are separated by a P2A siteDepositorInsertDjCas13d/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only