We narrowed to 9,370 results for: Pol;
-
Plasmid#62106PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a 7SK RNA polymerase III promoter for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseRNAi; Mule gateway entry vectorExpressionMammalianAvailable SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pFSW Syt1-C2A K189-192A IRES GFP
Plasmid#133823PurposeEncodes the C2A domain of synaptotagmin 1 with poly-lysine patch mutations K189-192A for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationK189-192APromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pFastBac(His10-Lckg2a,Y394F)
Plasmid#177893PurposeBaculo expression of His10 tag fused to human LckG2ADepositorAvailabilityAcademic Institutions and Nonprofits only -
pHCMM1
Plasmid#167452PurposeExpresses C.elegans PUP-2 linked to RNA-recognition motifs (RRMs) of yeast poly(A)-binding protein [PUP alone (+PAB)] from the TEF1 promoterDepositorInsertPTEF1_yeGFP_scPAB14RRMS_cePUP-2_URA3_TADH1
ExpressionYeastPromoterTEF1AvailabilityAcademic Institutions and Nonprofits only -
pHCMM2
Plasmid#167453PurposeExpresses C.elegans PUP-2 linked to RNA-recognition motifs (RRMs) of yeast poly(A)-binding protein [PUP alone (+PAB)] from the Sec63 promoterDepositorInsertPSEC63_yeGFP_scPAB14RRMS_cePUP-2_URA3_TADH1
ExpressionYeastPromoterPSEC63AvailabilityAcademic Institutions and Nonprofits only -
pHCMM3
Plasmid#167454PurposeA control chimera; expresses C. elegans PUP-2 from the Sec63 promoter without the RNA-recognition motifs (RRMs) of yeast poly(A)-binding protein [PUP alone (-PAB)]DepositorInsertPSEC63_yeGFP_cePUP-2_URA3_TADH1
ExpressionYeastPromoterPSEC63AvailabilityAcademic Institutions and Nonprofits only -
pLIB-GST-TEV-RSP3(160-516)
Plasmid#176692PurposeExpression of Chlamydomonas reinhardtii RSP3 recombinant protein in insect cellsDepositorInsertRSP3
TagsGSTExpressionInsectMutationNonePromoterpolyhedrinAvailabilityAcademic Institutions and Nonprofits only -
p2,0_3M5M_eGFP
Plasmid#135474PurposeEncodes Marburg virus minigenome with eGFP reporter gene under control of a T7 RNA polymerase promoterDepositorInsertMarburg virus minigenome, eGFP reporter
ExpressionMammalianMutationNonePromoterT7Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
AY27_pU6.gRNA.CLYBL
Plasmid#199238PurposeExpression construct encoding a S. pyogenes guide RNA targeting the human CLYBL safe harbor locusDepositorInsertS. pyogenes gRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNAAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBS CMV GAG
Plasmid#234992PurposeFor production of Viral like particles (VLPs) by expressing the MLV GAG protein in mammalian cellsDepositorInsertGAG
ExpressionMammalianMutationDeleted polymerase coding sequenceAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 Lysosomal-METRIQ
Plasmid#135401PurposeExpresses lysosomal-METRIQ (DNAse II-sfGFP together with cytosolic RFP) to measure lysosomal activityDepositorInsertDNAse II alpha (DNASE2 Human)
UseLentiviralTagsT2A, mCherry, and sfGFPExpressionMammalianMutationSingle-nucleotide polymorphism C432TAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBabePuro-ApoECDS
Plasmid#42949DepositorAvailable SinceMarch 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
AV44_pCAG.Cas9-D10A.gRNA.S1
Plasmid#199258PurposeExpression construct encoding SpCas9-D10A nickase and an AAVS1-targeting guide RNADepositorInsertsSpCas9-D10A nickase
AAVS1-targeting gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianMutationD10APromoterCAG promoter and RNA polymerase III promoter for …Available SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AV13_pCAG.Cas9.gRNA.NT
Plasmid#199260PurposeExpression construct encoding SpCas9 nuclease and a control non-targeting guide RNADepositorInsertsSpCas9 nuclease
Non-targeting (NT) control gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCAG promoter and RNA polymerase III promoter for …Available SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAV5B+longBRD4
Plasmid#157792PurposeExpression of long isoform of BRD4DepositorAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-GST-TBK1
Plasmid#221331PurposeTBK1 protein overexpression in Sf9 insect cellsDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
enIscB
Plasmid#205410PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_npNLS_polyA_pU6__RNA*_pCMV_mCherry
ExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET29b-AviTag-eGFP-dspB(E184Q W330Y)-6xHis
Plasmid#175801PurposePlasmid for overexpression of recombinant AviTagged, His-tagged fusion protein eGFP-DspB(E184Q W330Y), used as a non-binding control for detection of biofilm polysaccharide PNAG.DepositorInsertDispersin B
TagsAviTag, Hexahistidine tag, and eGFPExpressionBacterialMutationE184Q W330YPromoterT7Available SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac HT JS-Rab10wt
Plasmid#135557PurposeExpress mouse Rab10wt in Sf9 cells, the resulted plasmid encodes an N-terminally His6-tagged Munc18c protein with a tobacco etch virus (TEV) cleavage site between the His6 tag and Rab10wt.DepositorAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only