We narrowed to 31,746 results for: son

#113926

Plasmid encoding the cytosolic localization of the chimeric SNAP-NanoLuc fusion S-Luc in mammalian cells for BRET

Kai Johnsson

Hiblot et al Angew Chem Int Ed Engl. 2017 Nov 13;56(4

Sept. 18, 2018

Academic Institutions and Nonprofits only

#113927

Plasmid encoding the mitochondrial localization of the chimeric SNAP-NanoLuc fusion S-Luc in mammalian cells for BRET

Kai Johnsson

Hiblot et al Angew Chem Int Ed Engl. 2017 Nov 13;56(4

Sept. 14, 2018

Academic Institutions and Nonprofits only

#102716

Express DNA binding domain of human Zinc finger protein 57 in E. coli

Gary Stormo

Zuo et al Sci Adv. 2017 Nov 17;3(11):eaao1799. doi

Nov. 16, 2017

Academic Institutions and Nonprofits only

#89887

Human HRasG12V fused to mCherry downstream of LexOP, placed within a non-autonomous maize dissociation (Ds) element for integration in zebrafish. Contains pCrysB-ECFP for screening.

Tatjana Sauka-Spengler

Kenyon et al Dis Model Mech. 2018 Apr 6;11(4). pii: d

Aug. 9, 2017

Academic Institutions and Nonprofits only

#87361

Expresses GdT, a dimeric green fluorescent protein

Robert Campbell

Wiens et al Chembiochem. 2016 Oct 26. doi: 10.1002/c

May 16, 2017

Academic Institutions and Nonprofits only

#87403

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87404

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87382

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87384

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#67007

Expresses malE-SELP0K in E. coli

Ashutosh Chilkoti

Tang et al Nat Mater. 2016 Jan 4. doi: 10.1038/nmat

Jan. 5, 2016

Academic Institutions and Nonprofits only

#63624

KIF-R5-KIKR RNAP mutant

Andrew Ellington

Meyer et al ACS Synth Biol. 2014 Oct 7.

April 15, 2015

Industry, Academic Institutions, and Nonprofits

#57244

Localization: Focal Adhesions, Excitation: 400 / 490, Emission: 468 / 511

Michael Davidson

April 1, 2015

Industry, Academic Institutions, and Nonprofits