We narrowed to 9,183 results for: Pol
-
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGS_128
Plasmid#160651PurposeExpresses Human APOE3 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e3 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione3 allelePromoterpZ estradiol inducible promoterAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDHa_mDDX5_FL_wt
Plasmid#88869Purposeconstitutive expression of Ha-DDX5 in mammalian cellsDepositorAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGS_107
Plasmid#160650PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.RBBP4
Plasmid#125164PurposeExpresses human RBBP4 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorInsertHistone-binding protein RBBP4 (RBBP4 Human)
TagsHis-MBPExpressionInsectPromoterPolyhedrinAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDHa_mDDX5_FL_K144N
Plasmid#88870Purposeconstitutive expression of Ha-DDX5 K144N in mammalian cellsDepositorAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGS_129
Plasmid#160652PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterpZ estradiol inducible promoterAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc sfCherry2ΔC4-Lifeact
Plasmid#231557PurposeMammalian expression of Lifeact fused to C-terminally truncated superfolder Cherry2, for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
Donor_ANKRD1_KO_Puro
Plasmid#186667PurposeDonor plasmid to endogenously knock out the ANKRD1 in Hek293 cells. eEF1a promoter, puromycin and polyA sequence is inserted between two homology arms.DepositorInsertANKRD1 KO Puromycin (ANKRD1 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.AEBP2
Plasmid#125165PurposeExpresses human AEBP2 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Donor_YTHDF2_KO_Hygro
Plasmid#186671PurposeDonor plasmid to endogenously knock out the YTHDF2 in Hek293 cells. Hygromycin and polyA sequence is inserted between two homology arms.DepositorInsertYTHDF2 KO Hygromycin (YTHDF2 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Donor_YTHDF2_KO_Puro
Plasmid#186670PurposeDonor plasmid to endogenously knock out the YTHDF2 in Hek293 cells. Puromycin and polyA sequence is inserted between two homology arms.DepositorInsertYTHDF2 KO Puromycin (YTHDF2 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.neo_shGFP
Plasmid#110470PurposeControl, silence GFP gene, doxycycline inducible, neomycin selectionDepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCherry-CRY2-INPP5E
Plasmid#79561Purposeexpression of mCherry-tagged CRY2PHR fused to inositol 5-phosphatase domain of human INPP5E with mutated C-terminal CaaX-motifDepositorInsertINPP5E (INPP5E Human)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationC-terminal region, aa 214_644, C641A mutation to …PromoterCMVAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFl Strep-sumo-TEV-hAgo2 D597N
Plasmid#136236PurposeExpressing catalytically inactive human Argonaute-2 in insect cellsDepositorInserthuman Argonaute-2 (AGO2 Human)
TagsSterp SumoExpressionInsectMutationD597NPromoterpolyhedrinAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-SM
Plasmid#136578PurposeDox-inducible polycistronic lentiviral vector expressing mouse Sox2, cMycDepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
PTRF/Cavin1_L (OZ513)
Plasmid#27188DepositorInsertZinc finger array targeting PTRF/Cavin1 (cavin1b Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLIB_GST-nsp13 (SARS-CoV-2)
Plasmid#169190PurposeBaculoviral transfer vector to express GST-nsp13 (SARS-CoV-2) in insect cellsDepositorInsertGST-nsp13 (ORF1ab Synthetic, SARS-CoV-2)
TagsGSTExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
LIC4B-His-TEV-TAK1-TAB1
Plasmid#154874PurposeInsect cell optimized TAK1-TAB1 construct used to solve structure and deposit PDB ID: 4O91DepositorInsertTAK1-TAB1 (TAB1 Human)
TagsLIC TEV HisExpressionInsectMutationCodon optimizedPromoterpolyhedrinAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only