We narrowed to 4,483 results for: Gaa
-
Plasmid#174302PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #2 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.111
Plasmid#184980PurposeTest effect of extending a1/a2 on TRP2 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, TRP2 E64X, a1/a2 length: 27 v1
ExpressionYeastMutationTRP2 donor E64stop, a1/a2 length extended to 27 bpPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.110
Plasmid#184979PurposeExpress -Eco1 TRP2 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, TRP2 E64X, a1/a2 length: 12
ExpressionYeastMutationTRP2 donor E64stopPromoterGal7Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e1 and e4
Plasmid#190688PurposesgRNAs targeting enhancer 1 and 4 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 1 and 4 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056H
Plasmid#183135PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFB_ROSA26_SpCas9_gRNAs
Plasmid#174703PurposePlasmid containing separate SpCas9 gRNAs for targeted excision of inserted STOP Cassette upstream of reporter alleles found in Ai14 and Ai6 mice. ITRs flank the cassette for easy vector creation.DepositorInsertSpCas9 dual gRNAs
UseAAVAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDR-itga9_sgRNA1
Plasmid#132979Purposeitga9 sgRNA targeting to "5'-GAATGACGGAGCTCTCTACG-3" in pDR274DepositorInsertitga9 sgRNA1 target sequence
UseCRISPR; Sgrna generation vectorAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTBL322 GC
Plasmid#126950PurposeTo target a protospacer with GC at the cut site.DepositorInsertspacer against human genome with GC at cut site
ExpressionMammalianPromoterhuman U6Available SinceMay 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRNA[Tra].1026G
Plasmid#112689Purposeexpress gRNA targeting Tra under dU6-3 promoterDepositorInsertU6.3-gRNA[Tra] (tra Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pGS_C_3xFLAG
Plasmid#101653PurposeExpression of type I signal-peptide containing proteins with C-terminal 3xFLAG-tag in insect cellsDepositorInsertLRP6 Signal peptide, MCS linker, 3xFLAG tag
Tags3xFLAG tagExpressionInsectAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC34
Plasmid#104808PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr8g060730 (Fbl1-like). Also expresses Cas9 from AtUBQ10 promoterDepositorInsertMedtr8g060730
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC33
Plasmid#104807PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr8g060730 (Fbl1-like). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr8g060730
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC14
Plasmid#104788PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g044580 (ERDJ2). Also expresses Cas9 from AtUBQ10 promoterDepositorInsertMedtr2g044580
UseCRISPRExpressionPlantAvailable SinceJan. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC15
Plasmid#104789PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g044580 (ERDJ2). Also expresses Cas9 from rolD promoterDepositorInsertMedtr2g044580
UseCRISPRExpressionPlantAvailable SinceJan. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC13
Plasmid#104787PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g044580 (ERDJ2). Also expresses Cas9 from Gmubi promoterDepositorInsertMedtr2g044580
UseCRISPRExpressionPlantAvailable SinceJan. 29, 2018AvailabilityAcademic Institutions and Nonprofits only