We narrowed to 9,972 results for: crispr plasmids
-
Plasmid#175176PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting GrprDepositorInsertsgRNA-Grpr
UseAAV and CRISPRAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_4
Plasmid#155062PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV_Dbh HMEJ donor
Plasmid#97320PurposeHMEJ donor for fusing a p2A-mCherry-WPRE reporter to mouse Dbh. AAV backbone.DepositorInsertDbh HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
J8AAV-HDR Ctnnb1.1
Plasmid#73452PurposeJ8AAV-HDR U6sgCtnnb1.1 templateDepositorInsertCtnnb1 (Ctnnb1 Mouse)
UseAAVAvailable SinceFeb. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-crRNA(TBK1)
Plasmid#109322PurposeAAV vector expressing crRNA for AsCpf1 (RR variant) targeting human TBK1DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + M-AAT target
Plasmid#86008Purposelenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
M-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEPT_Cdk2-T160E-siR
Plasmid#73976PurposeHDR template to generate Cdk2-T160E-siRDepositorUseAAVMutationT160 mutated to Glu and siRNA target site mutatedAvailable SinceMarch 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330_H1.0
Plasmid#247482PurposeExpresses SpCas9 and a sgRNA targeting the human histone H1.0 loci for knock-in.DepositorAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTB106-Phleo
Plasmid#236780PurposeExpression of Cas9 cytosine base editor (CBE), T7 RNAP, Cas12a and phleomycin selection marker. The CBE contains a ssDNA-DBD from the L. major RAD51 protein. This plasmid is transfected as episome.DepositorInserthyBE4max (CBE); Cas12a (Acidaminococcus sp. BV3L6)-P2A-T7 RNAP
UseCRISPRAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTB107-Hyg
Plasmid#236781PurposeExpression of Cas9 cytosine base editor (CBE), T7 RNAP, Cas12a and hygromycin selection marker. The CBE contains a ssDNA-DBD from the H. sapiens RAD51 protein. This plasmid is transfected as episome.DepositorInserthyBE4max (CBE); Cas12a (Acidaminococcus sp. BV3L6)-P2A-T7 RNAP
UseCRISPRAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1157-HBEGF-2a-3xFLAG-BRCA1(full-length)-P1749S-2a-mRuby3-HBBIVS2-WPRE
Plasmid#248997PurposeThis plasmid expresses the BRCA1 sequence with P1749S mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1158-HBEGF-2a-3xFLAG-BRCA1(full-length)-R1699Q-2a-mRuby3-HBBIVS2-WPRE
Plasmid#248998PurposeThis plasmid expresses the BRCA1 sequence with R1699Q mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1159-HBEGF-2a-3xFLAG-BRCA1(full-length)-R1699W-2a-mRuby3-HBBIVS2-WPRE
Plasmid#248999PurposeThis plasmid expresses the BRCA1 sequence with R1699W mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1160-HBEGF-2a-3xFLAG-BRCA1(full-length)-S1655F-2a-mRuby3-HBBIVS2-WPRE
Plasmid#249000PurposeThis plasmid expresses the BRCA1 sequence with S1655F mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1161-HBEGF-2a-3xFLAG-BRCA1(full-length)-V1736A-2a-mRuby3-HBBIVS2-WPRE
Plasmid#249001PurposeThis plasmid expresses the BRCA1 sequence with V1736A mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1069-HBEGF-2a-3xFLAG-BRCA1(full-length)-A1708V-2a-mRuby3-HBBIVS2-WPRE
Plasmid#248989PurposeThis plasmid expresses the BRCA1 sequence with A1708V mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1066-HBEGF-2a-3xFLAG-BRCA1(full-length)-L1705R-2a-mRuby3-HBBIVS2-WPRE
Plasmid#248990PurposeThis plasmid expresses the BRCA1 sequence with L1705R mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1070-HBEGF-2a-3xFLAG-BRCA1(full-length)-Y1845D-2a-mRuby3-HBBIVS2-WPRE
Plasmid#248991PurposeThis plasmid expresses the BRCA1 sequence with Y1845D mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only