We narrowed to 14,066 results for: crispr grnas
-
Plasmid#215343PurposegRNA expression for S. stutzeri nifL deletion on an RSF1010 backboneDepositorInsertS. stutzeri nifL gRNA
UseCRISPR and Synthetic BiologyTagsNoneExpressionBacterialPromoterJ23119Available SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDYSCKO
Plasmid#120263PurposeEmpty backbone for cloning any gRNA to be used with the canavanine co-selection systemDepositorInsertDYSCKO cassette
UseCRISPR and Synthetic BiologyPromoterSNR52Available SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKlab965-PX459-BRCA1-Nterm-guide1
Plasmid#249005PurposeThis plasmid expresses the Cas9/gRNA that will target the HBEGF gene locusDepositorInsertCas9
UseCRISPRTags3xFLAGPromoterchicken beta-actin promoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLY86
Plasmid#130949PurposeEngineered sgRNA-LEA2-WTmis2 generator circuit including promoter Plux2, 2 BoxB aptamers and 2 mis-matches in sgRNA scaffoldDepositorInsertsgRNA-LEA2-WTmis2
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH50
Plasmid#128212Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH72
Plasmid#128221Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH73
Plasmid#128222Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSPCas9(BB)-2A-GFP_ABCA3GFP_targeting
Plasmid#188541PurposePlasmid encoding pCas9 and gRNA targeting the endogenous human ABCA3 locus stop codonDepositorInsertgRNA
UseCRISPRTagsGFPPromoterU6Available SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-CTNNB1-ATG
Plasmid#153429PurposeExpresses a gRNA that overlaps the startcodon of human CTNNB1DepositorAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459-CTNNB1-S45
Plasmid#164587PurposeExpresses a gRNA that overlaps the S45 codon of human CTNNB1DepositorAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSI-359
Plasmid#131131PurposegRNA expression vector for A-to-G base editing reporterDepositorInsertA-to-G reporter activation gRNA
UseCRISPRExpressionMammalianPromoterHuman U6 promoterAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSI-535
Plasmid#131130PurposegRNA expression vector for C-to-T base editing reporterDepositorInsertC-to-T reporter activation gRNA
UseCRISPRExpressionMammalianPromoterHuman U6 promoterAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pROF441
Plasmid#155336PurposeBinary vector for expression of a gRNA targeting AtAP1 promoterDepositorInsertLB_PAtU6-26-gRNA(PAtAP1)-sgRNA_RB
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_sgGFP4
Plasmid#119876PurposegRNA expression vectorDepositorInsertsgGFP
UseLentiviralExpressionMammalianAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_sgGFP3
Plasmid#119875PurposegRNA expression vectorDepositorInsertsgGFP
UseLentiviralExpressionMammalianAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo U6-SpAi9R-U6-SpDMDR
Plasmid#78609PurposeExpresses gRNAs (for SpCas9) targeting 3’ of Ai9 stop cassette and Dmd intron 23DepositorInsertU6-SpAi9R-U6-SpDMDR
UseUnspecifiedPromoterU6Available SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-CsALSgR1.1
Plasmid#245875PurposeGolden gate entry vector carrying the 1st gRNA for base editing in Carrizo citrange ALS geneDepositorInsertCsALS_gRNA1.1
UseCRISPR; Golden gate entry vector to expressing t…ExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only