We narrowed to 44,406 results for: ina
-
Plasmid#86759PurposeN-terminal HA-tagged protein expression in mammalian cellsDepositorInserthuman PRAS40 (AKT1S1 Human)
TagsHAExpressionMammalianMutationAA (S183A, S221A)PromoterCMVAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-deSpCas9-VP64-6xHis
Plasmid#92117PurposeExpression of dead/inactive increased fidelity eSpCas9 (1.1)-VP64-6xHis in bacterial cellsDepositorInsertdead/inactive eSpCas9-NLS-3xFLAG-VP64
UseCRISPRTags3xFLAG, 6xHis, NLS, and VP64ExpressionBacterialMutationD10A, H840A, K848A, K1003A, R1060APromoterT7Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
BMR1_01g02031-bio-His
Plasmid#108116Purpose[Edit] Expresses enzymatically monobiotinylated full-length BMR1_01g02031 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tagDepositorInsertBMR1_01g02031
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.a-AP-His
Plasmid#71984PurposeExpresses the extracellular region of the Netrin G1, isoform a protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Neo1.a-Fc-His
Plasmid#72089PurposeExpresses the extracellular region of the Neogenin 1, isoform a protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema5a-Fc-His
Plasmid#72161PurposeExpresses the extracellular region of the Sema5A protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP10-bio
Plasmid#47719PurposeExpresses enzymatically monobiotinylated full-length MSP10 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP10
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 Flag-Smad1 (4SP/AP+AAVA)
Plasmid#14955DepositorInsertSmad1 (4SP/AP+AAVA) (SMAD1 Human)
TagsFlagExpressionMammalianMutationFour Serine to Alanine mutations in the linker re…Available SinceMay 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-tdTomato-f
Plasmid#127092PurposeAn AAV genome with tet-inducible, Cre-dependent expression of farnesylated (f) tdTomatoDepositorInserttdTomato-f
UseAAVTagsfarnesylation signal from c-Ha-RasExpressionMammalianAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a-baPrs-hdNadV
Plasmid#91950PurposepET28a-baPrs-hdNadV is a bicistronic vector designed for the simultaneous expression of PRS from Bacillus amyloliquefaciens and NadV from Haemophilus ducreyiDepositorInsertsPutative Nicotinamide Phosphoribosyl Transferase (nadV Haemophilus ducreyi, strain: ATCC 27722)
Phosphoribosyl Pyrophosphate Synthetases
ExpressionBacterialMutationchanged Leucine 135 to IsoleucinePromoterT7Available SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-pmEMBer
Plasmid#174441PurposePlasma membrane-targeted ERK monobody binder for local inhibition of ERK activity in live cells.DepositorInsertpmEMBer
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 GW-mCit-PA
Plasmid#113449PurposeProteinA-mCitrine Gateway shuttle vector for C-terminal fusionsDepositorTypeEmpty backboneUseGateway shuttle vectorTagsmCitrine-ProteinAExpressionMammalianPromoterCMVAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
FusionRed-Dectin1A-C-10
Plasmid#56111PurposeLocalization: Membrane, Excitation: 580, Emission: 608DepositorAvailable SinceApril 1, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
GFP-IP3KC
Plasmid#134603PurposeExpresses IP3KC GFP taggedDepositorAvailable SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-pro-siRNA-V2-TP53
Plasmid#111089PurposepET-pro-siRNA-V2 based plasmid for production of recombinant siRNAs (pro-siRNAs) against human TP53 gene.DepositorInsertTP53 (TP53 Human)
ExpressionBacterialAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA Myc-mMEKK2
Plasmid#44158DepositorAvailable SinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-AMPKsub(TA)-YPet-NES
Plasmid#84636PurposeEncodes negative-control C-terminal (substrate) fragment of bimolecular AMPK/BRSK activity reporter (bimABKAR); cytosol targeted; use in conjunction with pcDNA3-Cerulean-FHA1-NESDepositorInsertAMPKsub(TA)-YPet-NES
Tags6xHis, Nuclear export signal (NES), T7 tag (gene …ExpressionMammalianMutationTarget Thr residue in substrate domain mutated to…PromoterCMVAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
MTRAP-bio
Plasmid#68530PurposeExpresses full-length P. vivax MTRAP ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequenceDepositorInsertMTRAP
Tagsrat CD4 d3+4, enzymatic biotinylation sequenceExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
GST-GIV-CT
Plasmid#69863PurposeBacterial expression of GST tagged GIV-CTDepositorInsertGIV/Girdin (CCDC88A Human)
TagsGSTExpressionBacterialMutationC terminal amino acids 1623-1870 of human GIVPromoterTACAvailable SinceNov. 4, 2015AvailabilityAcademic Institutions and Nonprofits only