We narrowed to 12,371 results for: nsf
-
Plasmid#187180PurposeExpresses red norepinephrine indicator nLightR in neuronal cellsDepositorHas ServiceAAV9InsertnLightR
UseAAVTagsFlag tagPromoterhuman Synapsin-1Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-dCas9-dMQ1-EGFP
Plasmid#89637PurposeTargeted CpG methylationDepositorInsertsite-specific DNA-methyltransferase SssI
UseCRISPRTags3*FLAG, 6*His, and T2A-EGFPExpressionMammalianMutationC141S, TGC-->TCC; S317A, AGC-->GCCPromoterCMVAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-MCS-pA
Plasmid#233031PurposeTo express a DjCas13d-compatible gRNADepositorInsertDjCas13d-compatible gRNA expression cassette
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40
Plasmid#100849PurposeAAV expression of Cre recombinase-activated jRCaMP1b, a red fluorescent calcium sensor protein, from the CAG promoterDepositorHas ServiceAAV1InsertjRCaMP1b
UseAAVExpressionMammalianPromoterCAGAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6gRNA1-U6gRNA2-TnT-Cre
Plasmid#87682PurposeAAV vector for U6 driven expression of two gRNAs, and cardiomyocyte specific expression of Cre recombinase.DepositorInsertsgRNA1
gRNA2
Cre
UseAAVPromoterU6 and cTnTAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40
Plasmid#100846PurposeAAV expression of Cre recombinase-activated jRCaMP1a, a red fluorescent calcium sensor protein, from CAG promoterDepositorHas ServiceAAV1InsertjRCaMP1a
UseAAVExpressionMammalianPromoterCAGAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLPCX-Cx43-IRES-GFP
Plasmid#65433PurposeMammalian expression of Cx43 and EGFP seperately driven by the ECMV IRES. For transfection or retroviral productionDepositorAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pTH-iCre:EGFP-WPREpA
Plasmid#213142PurposeTruncated rat TH promoter expressing iCre fused to EGFPDepositorInsertiCre
UseAAVTagsEGFPExpressionMammalianPromoterTruncated TH promoter from rat (Rattus norvegicus…Available SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-H2BC11-MMEJ
Plasmid#227333PurposeMMEJ Donor template for mStayGold-2A-Puro insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorInsertH2BC11 Short Homology Arms flanking a mStayGold-2A-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TPH2-Cre
Plasmid#189616PurposeExpresses Cre recombinase under the control of the tryptophan hydroxylase promoterDepositorInsertCre Recombinase
UseAAVExpressionMammalianPromoterTph2Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
GAMA-bio
Plasmid#47747PurposeExpresses enzymatically monobiotinylated full-length GAMA ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised GAMA
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBOB-HA-Gna12
Plasmid#246004PurposeExpress HA N-terminal tagged mouse Galpha12 transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.DepositorAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.HaloTag
Plasmid#244094PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.H348H.HaloTag
Plasmid#244095PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
RhopH2-bio
Plasmid#47798PurposeExpresses enzymatically monobiotinylated full-length RhopH2 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RhopH2
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-TUBA1B
Plasmid#227327PurposeDonor template for mStayGold insertion into the N-terminus of the TUBA1B locus. For tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763)DepositorInsertTUBA1B Homology Arms flanking a mStayGold Tag (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-VGAT-WPRE-pA
Plasmid#39320DepositorInsertSlc32a1 (Slc32a1 Mouse)
UseAAV; RAvailable SinceOct. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nef-CIAO-Flp
Plasmid#149294PurposeCre-dependent expression of Flp recombinase.DepositorInsertFlp recombinase (flp Budding Yeast)
UseAAVMutationDerived from the mouse codon-optomized FlpO. The…Available SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only