We narrowed to 9,707 results for: crispr plasmids
-
Plasmid#153226PurposeControl plasmid for knockout of TRY and CPC genesDepositorInsertCas9, guide RNA for AP3, FAST marker
UseSynthetic BiologyAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV8-cPE-N
Plasmid#183538PurposeDeliver a split compact Prime Editor in vivoDepositorInsertN-terminal fragment of SpCas9 nickase (H840A)
UseAAVExpressionMammalianAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRN3P_T3_ABEmax_IVT
Plasmid#171761PurposePlasmid to be used as DNA template for in-vitro RNA transcription of the ABEmax base editor (A to G) by T3 RNA polymeraseDepositorInsertABEmax
UseVector for in-vitro transcriptionPromoterT3 promoterAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRN3P_T3_BE4_IVT
Plasmid#171762PurposePlasmid to be used as DNA template for in-vitro RNA transcription of the BE4 base editor (C to T) by T3 RNA polymeraseDepositorInsertBE4
UseVector for in-vitro transcriptionPromoterT3 promoterAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAGM55361
Plasmid#153227PurposeControl plasmid for knockout of AP3 geneDepositorInsertCas9, guide RNA for TRY and CPC and FAST marker
UseSynthetic BiologyAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNAEmptyVector_Puro_T2A_BFP2
Plasmid#236729PurposeDual sgRNA empty vector expressing BFP with Puromycin selectionDepositorTypeEmpty backboneUseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_PHF1_sgRNA
Plasmid#246403PurposeCas9/sgRNA expression plasmid targeting PHF1DepositorInsertPHF1 (PHF1 Human)
ExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG297-(Sp-gRNA)-(Sa-gRNA)-(PuroR_T2A_BFP(C>T screening))
Plasmid#239448PurposeOrthogonal dual Cas9 gRNA and BFP reporter lentivirus cassette plasmid. For use with S. pyogenes and S. aureus gRNAs and includes a BFP reporter which reports on C-to-T editing.DepositorInsertsS.p. gRNA backbone
S.a. gRNA backbone
PuroR-T2A-BFP(C>T_screening)
UseLentiviralExpressionMammalianMutationBFP: T65S, S72S, V145F, K206K, H231LPromoterEF1alpha, U6, and mU6Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-GFP
Plasmid#238041PurposeEncodes sfGFP under lac promoter. Expresses a single guide RNA (under Rha promoter), which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceJune 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-RFP
Plasmid#238040PurposeEncodes mRFP1 under pLux promoter. Expresses a single guide RNA (under Ara promoter), which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertmRFP1
UseSynthetic BiologyPromoterLuxAvailable SinceJune 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget
Plasmid#238033PurposeEncodes sfGFP-SsrA under constitutive promoter (J23119). Expresses a single guide RNA, which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsssrAPromoterJ23119 (constitutive)Available SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
FB395
Plasmid#203631PurposeTU for the expression of luciferase under a synthetic promoter containing the target sequence for gRNA1 (1xLuc).DepositorInsertR1:G1aG2b.1:mPAF:Luc:TtrpC
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB396
Plasmid#203632PurposeTU for the expression of luciferase under a synthetic promoter containing two copies of the target sequence for gRNA1 (2xLuc).DepositorInsertR1:G1ab.1:mPAF:Luc:TtrpC
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB397
Plasmid#203633PurposeTU for the expression of luciferase under a synthetic promoter containing three copies of the target sequence for gRNA1 (3xLuc).DepositorInsertR1:G1abc.3:mPAF:Luc:TtrpC
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_ST-sgRNA
Plasmid#188705PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and 4 sgRNAs targeting human safe targeting lociDepositorInsertST sgRNAs
UseLentiviralExpressionMammalianPromoterhUbCAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.103
Plasmid#184988PurposeExpress Cas9-P2A-Eco1RTDepositorInsertCas9-P2A-Eco1RT
TagsSV40NLSExpressionYeastMutationhuman codon optimized RTPromoterGal1-10Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.102
Plasmid#184987PurposeExpress -Eco1 RT-P2A-Cas9DepositorInsertEco1RT-P2A-Cas9
TagsSV40NLSExpressionYeastMutationhuman codon optimized RTPromoterGal1-10Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only