We narrowed to 15,000 results for: GRN
-
Plasmid#68253PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting PM19_1 in barleyDepositorInsertPromote:TaU6+sgRNA HvPM19_1
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
shTBX5 # 2
Plasmid#42550DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSMP-SMYD2_3
Plasmid#36351DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD1_1
Plasmid#36365DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD1_2
Plasmid#36366DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSSBIO32_dCas9_RPA1786
Plasmid#240489PurposeCRISPRi-mediated Knockdown of RPA1786DepositorInsertCas9 (cas9 Streptococcus pyogenes)
UseCRISPRExpressionBacterialMutationD10A, H840APromoterPlacAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYAP1-3
Plasmid#193666PurposeTet inducible knockdown of YAP1DepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shYAP1-1
Plasmid#193692PurposeConstitutive lentiviral expression of YAP1 shRNADepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
VPS35 shRNA2
Plasmid#163859PurposeshRNA targeting the coding sequences of VPS35DepositorInsertVPS35 retromer complex component (VPS35 Human)
ExpressionMammalianAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgCTNNB1 Nicking
Plasmid#169845PurposeExpress a nicking sgRNA used for installation of the oncogenic S45F or S45del in Ctnnb1 in mouse liver.DepositorInsertsgCTNNB1 Nicking (Ctnnb1 Mouse)
ExpressionMammalianAvailable SinceJune 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pegCTNNB1 S45del
Plasmid#169844PurposepegRNA used for installation (via TCC deletion) of the oncogenic S45del in Ctnnb1 in mouse liver.DepositorInsertpegCTNNB1 S45DEL (Ctnnb1 Mouse)
ExpressionMammalianAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pegCTNNB1 S45F
Plasmid#169843PurposepegRNA used for installation (via C•G-to-T•A) of the oncogenic S45F in Ctnnb1 in mouse liver.DepositorInsertpegCTNNB1 S45F (Ctnnb1 Mouse)
ExpressionMammalianAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTFAM.1.0-gDNA
Plasmid#132443PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertTFAM (TFAM Human)
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-shWRN2
Plasmid#125782Purposeconstitutive expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN2 (WRN Human)
UseRNAiAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN-EIJ
Plasmid#125774Purposeconstitutive expression of a guide RNA targeting an exon-intron junction of human WRNDepositorInsertsgWRN-EIJ (WRN Human)
UseCRISPRAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9N863Anickase.EF1a-BFP.sgLMNApair1
Plasmid#98976PurposeCas9 Homologous Recombination Reporter. SpCas9N863A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 44bp 3' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 1 and Cas9(N863A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair1
Plasmid#98972PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNA targeting hLMNA. Generates breaks with 44bp 5' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 1 and Cas9(D10A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN022
Plasmid#91668PurposeExpress sgRNA targeting human SHANK3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSuper.mBeta826
Plasmid#12549DepositorInsertshRNA to mouse polymerase beta
UseRNAi and RetroviralExpressionMammalianAvailable SinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only