We narrowed to 968 results for: lentiviral vector plasmid
-
Plasmid#208383PurposeThis sgControl, located in the TP53BP1 intron, serves as a control sgRNA for the others. The vector was cloned from Lenti-sgRNA-Cre-GpNLuc.DepositorInsertsgControl (TP53BP1 intron) (Trp53bp1 Mouse)
UseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-CD19.8H.8TM.28.BB.3z
Plasmid#200672PurposeModular CD8hinge-CD8transmembrane-CD28-41BB-CD3z CAR backbone, For Transient Expression or Lentiviral ProductionDepositorUseLentiviralTagsMycTagExpressionMammalianPromoterEF1a-shortAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-CD19.8H.8TM.BB.28.3z
Plasmid#200673PurposeModular CD8hinge-CD8transmembrane-41BB-CD28-CD3z CAR backbone, For Transient Expression or Lentiviral ProductionDepositorUseLentiviralTagsMycTagExpressionMammalianPromoterEF1a-shortAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-CD19.8H.28TM.28.BB.3z
Plasmid#200676PurposeModular CD8hinge-CD28transmembrane-CD28-41BB-CD3z CAR backbone, For Transient Expression or Lentiviral ProductionDepositorUseLentiviralTagsMycTagExpressionMammalianPromoterEF1a-shortAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-CD19.8H.28TM.BB.28.3z
Plasmid#200677PurposeModular CD8hinge-CD28transmembrane-41BB-CD28-CD3z CAR backbone, For Transient Expression or Lentiviral ProductionDepositorUseLentiviralTagsMycTagExpressionMammalianPromoterEF1a-shortAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
KH001: pMVP (L3-L2) V5 epitope tag + WPRE
Plasmid#121762PurposepMVP L3-L2 entry plasmid, contains V5 epitope tag + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest in lentivirus vectors.DepositorInsertV5 epitope tag + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KH101: pMVP (L3-L2) HA epitope tag + WPRE
Plasmid#121756PurposepMVP L3-L2 entry plasmid, contains HA epitope tag + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest in lentivirus vectors.DepositorInsertHA epitope tag + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IX907: pMVP (L3-L2) 3x epitope tag + WPRE
Plasmid#121757PurposepMVP L3-L2 entry plasmid, contains 3x HA epitope tag + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest in lentivirus vectors.DepositorInsert3x HA epitope tag + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KN401: pMVP (L3-L2) FKBP DD + WPRE
Plasmid#121792PurposepMVP L3-L2 entry plasmid, contains FKBP DD + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows fusion of C-term FKBP degron domain (stabilized by SHLD1) to gene in lentivirus vectors.DepositorInsertFKBP Degron Domain + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KN501: pMVP (L3-L2) ecDHFR DD + WPRE
Plasmid#121793PurposepMVP L3-L2 entry plasmid, contains ecDHFR DD + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows fusion of C-term ecDHFR degron domain (stablized by TMP) to gene in lentivirus vectorsDepositorInsertecDHFR Degron Domain + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
JA001: pMVP (L3-L2) FLAG epitope tag + WPRE
Plasmid#121758PurposepMVP L3-L2 entry plasmid, contains FLAG epitope tag + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest in lentivirus vectors.DepositorInsertFLAG epitope tag + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IZ901: pMVP (L3-L2) OLLAS epitope tag + WPRE
Plasmid#121759PurposepMVP L3-L2 entry plasmid, contains OLLAS epitope tag + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest in lentivirus vectors.DepositorInsertOLLAS epitope tag + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IZ702: pMVP (L3-L2) myc epitope tag + WPRE
Plasmid#121760PurposepMVP L3-L2 entry plasmid, contains myc epitope tag + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest in lentivirus vectors.DepositorInsertmyc epitope tag + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IZ801: pMVP (L3-L2) 6x His epitope tag + WPRE
Plasmid#121761PurposepMVP L3-L2 entry plasmid, contains 6x His epitope tag + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest in lentivirus vectors.DepositorInsert6x His epitope tag + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-Oct4-p2a-Sox2-17-t2a-Klf4-e2a-cMyc
Plasmid#193346PurposetetO-OS*KM (Dox-inducible reprogramming lentiviral vector expressing mouse Oct4 + super-Sox + Klf4 + cMyc)DepositorUseLentiviralExpressionMammalianMutationSox2-17 is engineered highly cooperative chimeric…PromoterTetO mini CMVAvailable SinceFeb. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-WWE-HA-nLuc-FLAG-T2A-WWE-myc-cLuc-FLAG-IRES-Puro
Plasmid#187611PurposeSplit luciferase construct with nLuc fused to C-terminus of WWE domain, linked by T2A to cLuc fused to C-terminus of WWE domain, linked by IRES to puromycin resistance cassetteDepositorInsertsWWE domain with C-terminal nLuc
WWE domain with C-terminal cLuc
UseLentiviralTagsFLAG, HA, Split luciferase (cLuc), Split lucifera…ExpressionMammalianPromoterEF1AAvailable SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-WWE(R163A)-HA-nLuc-FLAG-T2A-WWE-myc-cLuc-FLAG-IRES-Puro
Plasmid#187612PurposeSplit luciferase construct with nLuc fused to C-terminus of WWE domain with Arg163Ala mutation, linked by T2A to cLuc fused to C-terminus of WWE domain, linked by IRES to puromycin resistance cassetteDepositorInsertsWWE domain (R163A) with C-terminal nLuc
WWE domain with C-terminal cLuc
UseLentiviralTagsFLAG, HA, Split luciferase (cLuc), Split lucifera…ExpressionMammalianMutationArg163AlaPromoterEF1AAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti NLuc398-hLGALS8 IRES hCALCOCO2-CLuc394
Plasmid#128387PurposeExpresses a split firefly luciferase reporter based on the full length, human Gal8 and CALCOCO2, which interact following endosomal disruptionDepositorUseLentiviral, Luciferase, and Synthetic BiologyTagsCLuc394 and NLuc398ExpressionMammalianPromoterEFS and IRESAvailable SinceJan. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-LucAL
Plasmid#174049PurposeExpresses mALG8 (ITYTWTRL) and mLAMA4 (VGFNFRTL) antigens as a fusion to luciferase and Cre recombinaseDepositorInsertLucAL
UseCre/Lox, Lentiviral, and LuciferaseTagsLuciferaseExpressionMammalianMutationALG8 alanine 506 to threonine; LAMA4 glycine 1254…PromoterHuman Ubiquitin CAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only