We narrowed to 9,812 results for: Met;
-
Plasmid#159929PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.DepositorInsertgRNA mouse H19-DMR (H19-icr Mouse)
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6, CBhAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-cpCerulean3-FLARE-AKAR
Plasmid#123336PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity. Contains monomeric Cerulean3/cpCerulean3-E173 homoFRET pair.DepositorInsertCerulean3-cpCerulean3-FLARE-AKAR
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), Xpress…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-PMP34-DDRGK1-dTM-HA
Plasmid#139862PurposeLentiviral expression of PMP34-DDRGK1-dTM-HADepositorInsertPMP34-DDRGK1-dTM (DDRGK1 Human)
UseLentiviralTagsHAMutationrecombinant fusion of PMP34 (full length) with DD…Available SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRK5 FLAG membrane-bound lipin-1 (delta200)
Plasmid#120278PurposeExpression of ER/Golgi-tethered lipin-1 in mammalian cellsDepositorInsertLipin-1 (Lpin1 Mouse)
TagsFLAG and in-frame fusion with the delta200 Golgi-…ExpressionMammalianPromoterCMVAvailable SinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 K659M 3xFlag
Plasmid#110112Purposeexpresses FGFR2 with a single amino acid change in mammalian cellsDepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Lysine 659 to Methiionine (K659M)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMT mir-1-1 reporter cel-mir-240
Plasmid#46742DepositorInsertcel-mir-240
UseRNAiTagsHis and hsa-mir-1-1ExpressionInsectPromoterMetallothionein (MT)Available SinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMT mir-1-1 reporter cel-mir-230
Plasmid#46741DepositorInsertcel-mir-230
UseRNAiTagsHis and hsa-mir-1-1ExpressionInsectPromoterMetallothionein (MT)Available SinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-22HT-MSI1(7-192)R53E/R61E
Plasmid#60354PurposeR53E R61E double mutant of the mouse MSI1 RBDDepositorInsertmouse MSI1 (7-192) (Msi1 Mouse)
TagsHis and TEV protease siteExpressionBacterialMutationR53E and R61E mutations; contains amino acids 7-1…PromoterT7Available SinceNov. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
Khc73(1-387)-GFP
Plasmid#31747DepositorInsertKhc73 (Khc-73 Fly)
TagsGFPExpressionMammalianMutationContains only aa 1-387PromoterMetallothioneinAvailable SinceNov. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
Khc73(1-432)-GFP
Plasmid#31748DepositorInsertKhc73 (Khc-73 Fly)
TagsGFPExpressionMammalianMutationContains only aa 1-432PromoterMetallothioneinAvailable SinceNov. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Hygro dn-cHSF1
Plasmid#134732PurposeLentiviral expression vector for constitutively active dominant-negative HSF1DepositorInsertdn-cHSF1 (HSF1 Human)
UseLentiviralExpressionMammalianMutationDeletion of amino acids 186-202, 379−529PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV/TO Zeo dn-cHSF1
Plasmid#134734PurposeLentiviral expression vector for inducible expression of a constitutively active dominant-negative HSF1DepositorInsertdn-cHSF1 (HSF1 Human)
UseLentiviralExpressionMammalianMutationDeletion of amino acids 186-201, 380−529PromoterCMV/TOAvailabilityAcademic Institutions and Nonprofits only -
pc5139-pEGFP-H3.1-K36M
Plasmid#241430PurposeExpresses human Histone H3.1 as fusion to GFP with lysine to methionine point mutation of K36 from plasmid H3.1 using primers: forward: ACCGGTGGCGTGATGAAACCTCATCGC & reverse: GCGATGAGGTTTCATCDepositorInserthuman Histone H3.1 (H3C1 Human)
TagsEGFPExpressionMammalianMutationlysine at position 36 to methionine (K36M)PromoterCMVAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pNos-myrGFP
Plasmid#253595PurposeExpress myrGFP under Drosophila nanos promoterDepositorInsertmyrGFP
Tagsmyristoylation signalExpressionInsectPromoterNanos promoterAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-FLAG-HA-CAD_S1900A-HA-IRES-Neo
Plasmid#253789PurposepLV lentiviral expression vector encoding FLAG- and HA-tagged human CAD bearing S1900A mutation linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorInsertCAD (CAD Human)
UseLentiviralTagsFLAG-HA and HAExpressionMammalianMutationS1900APromoterEF1alphaAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1alpha-FLAG-HA-CAD_WT-HA-IRES-Neo
Plasmid#253784PurposepLenti lentiviral expression vector encoding FLAG- and HA-tagged human wild-type CAD linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1alpha-FLAG-HA-CAD_S1900A-HA-IRES-Neo
Plasmid#253785PurposepLenti lentiviral expression vector encoding FLAG- and HA-tagged human CAD bearing S1900A mutation linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorInsertCAD (CAD Human)
UseLentiviralTagsFLAG-HA and HAExpressionMammalianMutationS1900APromoterEF1alphaAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1alpha-FLAG-HA-CAD_S1900D-HA-IRES-Neo
Plasmid#253786PurposepLenti lentiviral expression vector encoding FLAG- and HA-tagged human CAD bearing S1900D mutation linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorInsertCAD (CAD Human)
UseLentiviralTagsFLAG-HA and HAExpressionMammalianMutationS1900DPromoterEF1alphaAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-FLAG-HA-CAD_S1900D-HA-IRES-Neo
Plasmid#253790PurposepLV lentiviral expression vector encoding FLAG- and HA-tagged human CAD bearing S1900D mutation linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorInsertCAD (CAD Human)
UseLentiviralTagsFLAG-HA and HAExpressionMammalianMutationS1900DPromoterEF1alphaAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-FLAG-HA-CAD_WT-HA-IRES-Neo
Plasmid#253788PurposepLV lentiviral expression vector encoding FLAG- and HA-tagged human wild-type CAD linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorAvailable SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only