We narrowed to 35,209 results for: LAT
-
Plasmid#18883DepositorAvailable SinceAug. 14, 2008AvailabilityAcademic Institutions and Nonprofits only
-
PKA-N-HiBiT
Plasmid#211377PurposeBacterially expressed HiBiT-PKA for Ni-NTA purificationDepositorInsertHuman protein kinase cAMP-activated catalytic subunit alpha (PRKACA) transcript variant 1, with N-terminal HiBiT (PRKACA Human)
Tags10xHis-tag with thrombin site and HiBiT TagExpressionBacterialPromoterT7 PromotorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV uN2C GFP (Ctl)
Plasmid#224355PurposeExpress GFP tagged upsteram ORF of NOTCH2NLC with a control size (12x) of GGC repeatsDepositorInsertuN2C
UseAAVTagseGFPExpressionMammalianMutationCodon-optimized for expression in human, so no pu…PromoterCMV + chimeric intyron (CAG)Available SinceOct. 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
2xMARS
Plasmid#205233PurposeExpresses two repeats of PLEKHA5 aa 143-271 (K163A and R164A) fused to mScarlet-iin mammalian cellsDepositorInserttwo repeats of PLEKHA5 aa 143-271 with K163A and R164A mutations (PLEKHA5 Human)
TagsNuclear Export Sequence and mScarlet-iExpressionMammalianMutationamino acids 143-271 of PLEKHA5 (GenBank reference…PromoterCMVAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
PGK mScarlet-LC3B
Plasmid#200083PurposeMammalian expression of fluorescently-tagged marker for autophagic vesiclesDepositorAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-GluN2B [N59/20R]
Plasmid#177565PurposeMammalian Expression Plasmid of anti-GluN2B/NR2B glutamate receptor (Rat). Derived from hybridoma N59/20.DepositorInsertanti-GluN2B/NR2B glutamate receptor (Rattus norvegicus) recombinant mouse monoclonal antibody (Grin2b Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-AAVS1-mNG-CAAX
Plasmid#183870PurposeRepair template for the stable expression of a mNeonGreen-CAAX fusion in human cells using CRISPR/Cas9.DepositorInsertAAVS1 homology arms with CMV-driven mNeonGreen-CAAX fusion (AAVS1 Human)
UseCRISPR; Donor templateTagsmNeonGreen-CAAXExpressionMammalianMutationHomology arms contain point mutations to remove t…PromoterCMVAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
VPS26C_pcDNA6.2/EmGFP-Bsd
Plasmid#176982PurposeMammalian expression vector encoding VPS26C and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-VDAC1 [N152B/23R]
Plasmid#177502PurposeMammalian Expression Plasmid of anti-VDAC1 (Human). Derived from hybridoma N152B/23.DepositorInsertanti-VDAC1 (Homo sapiens) recombinant mouse monoclonal antibody (VDAC1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-c-Fos [N486/76R]
Plasmid#177560PurposeMammalian Expression Plasmid of anti-c-Fos (Human). Derived from hybridoma N486/76.DepositorInsertanti-c-Fos (Homo sapiens) recombinant mouse monoclonal antibody (FOS Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-Pan-Synapsin [L125/129R]
Plasmid#177472PurposeMammalian Expression Plasmid of anti-Pan-Synapsin (Human). Derived from hybridoma L125/129.DepositorInsertanti-Pan-Synapsin (Homo sapiens) recombinant mouse monoclonal antibody
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEXPqcxip-hCCDC47-FLAG
Plasmid#159141PurposeHu CCDC47 -flag mammalian expression Gateway vector.DepositorInsertcoiled-coil domain containing 47 (CCDC47 Human)
UseRetroviralTagsFLAGExpressionMammalianPromoterCMV (cytomegalovirus) enhancer and the MSV (mouse…Available SinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA
Plasmid#113692PurposeU6 SaCas9 gRNA expression cassette containing a gRNA targeting the CREB gene, followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [ChrimsonR-GFP]
Plasmid#108273PurposeAAV-mediated expression of ChrimsonR-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterEF1α promoter (1.1kb short version)Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
CS2 Flag-Smad2 (3A)
Plasmid#101763PurposeExpresses SMAD2 (3A) in mammalian cellsDepositorInsertSMAD2 (SMAD2 Human)
TagsFlagExpressionMammalianMutationThree Ser to Ala mutations in the phosphorylation…PromoterCMVAvailable SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCherry-CRY2-P14P5K
Plasmid#79570Purposeexpression of mCherry-tagged CRY2PHR fused to iSH2 domain of mouse Pip5k1cDepositorInsertPip5k1c (Pip5k1c Mouse)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationR445E and R446E; truncation of amino acids 636-66…PromoterCMVAvailable SinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
Flag_MmPERK_S503_N1114_pBabePuro
Plasmid#58423Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant mouse PERK deleted from amino acids M1 to Y502. The remaining amino acids are S503 to N1114.DepositorInsertPERK (Eif2ak3 Mouse)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationDeleted amino acids M1 to Y502Available SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
Alpha MHC-DN.JNK2
Plasmid#51931Purposemammalian expression of dominant negative JNK2DepositorInsertDN JNK2 (Mapk9 Mouse)
TagsHAExpressionMammalianMutationdominant negative: the dual phosphorylation moti…Promotercardiac-specific α-myosin heavy chain 5.5 kb pro…Available SinceJune 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
GAMA-bio
Plasmid#47747PurposeExpresses enzymatically monobiotinylated full-length GAMA ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised GAMA
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only