We narrowed to 27,307 results for: GFP
-
Plasmid#83564PurposeExpresses a GFP-RFP FRET sensor containing the catalytic domain of PKCalpha and a short peptide substrate derived from the EGF receptor.DepositorInsertPKC alpha (PRKCA Human)
Tags10 nm ER/K Helix, FLAG purification tag, TEV Prot…ExpressionBacterial and InsectMutationOnly catalytic domain of PKC (aa 335-672)PromoterT7 PromoterAvailable sinceNov. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Unc104_K560GFP
Plasmid#129773PurposeExpresses worm Kinesin-3 Unc104 head and neck linker, dimerized through kinesin-1 neck-coil and coil-1 to 560 and GFP taggedDepositorInsertUnc104 (unc-104 Nematode)
TagsGFP and His6ExpressionBacterialMutationTruncation at 361, fused to kinesin-1 starting Al…Available sinceNov. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-H2BsfGFP-tdTomato - T2A APGST -XE
Plasmid#113839PurposeHistone H2B-superfolder GFP and tdTomato linked by T2A (APGST linker -XE)DepositorInsertH2B-sfGFP-T2A-tdTomato
ExpressionMammalianAvailable sinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO GFP hBub1 K821R
Plasmid#59813PurposeAllows the integration of GFP hBub1 K821R in the genome and Tet-inducible expression.DepositorInsertBub1 (BUB1 Human)
TagsEmGFPExpressionMammalianMutationK821RPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable sinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
cTRE-GFP-miR30_shRen
Plasmid#135666PurposeIntroduce Dox-inducible (TRE promoter) GFP cDNA plus miR30-embedded shRenilla into (ES) cells by recombination-mediated cassette exchangeDepositorInsertshRenilla
UseMouse TargetingAvailable sinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFastBac_HT_B_6xHis-TEV-GFP-NBR1
Plasmid#190928PurposePlasmid for the expression and purification of GFP labelled NBR1. Internal reference: SMC 914DepositorAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-GFP-LC3-mRuby3
Plasmid#184898PurposeStable expression of GFP-LC3-mRuby3 in mammalian cells to measure autophagic fluxDepositorInsertLC3B
TagsEGFP and mRuby3ExpressionMammalianAvailable sinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tollip M240A,F241A
Plasmid#178051PurposeGFP fused to human Tollip cDNA carrying mutations in the CUE domain. Localisation and expression in mammalian cells.DepositorInsertToll-Interacting Protein (TOLLIP Human)
TagsGFPExpressionMammalianMutationChanged Methionine 240 to Alanine and changed Phe…PromoterCMVAvailable sinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBSU6-shTim23/CMV-eGFP
Plasmid#89795PurposeExpresses shRNA against TIM23 with a separate promoter for expression of GFP.DepositorInsertshRNA Tim23 (Timm23 Mouse)
TagseGFP under separate promoterExpressionMammalianPromoterU6Available sinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
2xMARS-nGFP
Plasmid#205235PurposeExpresses two repeats of PLEKHA5 aa 143-271 (K163A and R164A) fused to a HA-tagged GFP nanobody in mammalian cellsDepositorInsert2xPLEKHA5(143-271)-K163A/R164A-HA-nGFP (PLEKHA5 Human)
TagsHA, Nuclear Export Sequence, mScarlet-i, and nGFP…ExpressionMammalianMutationamino acids 143-271 of PLEKHA5 (GenBank reference…PromoterCMVAvailable sinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pATZ-BFP-HA-GFP11
Plasmid#177721PurposeER protein alpha-1-antitrypsin containing E342K mutation (ATZ mutant) fused to blue fluorescence protein (BFP) tag protein, an HA tag and the eleventh β-strand of GFPDepositorInsertalpha-1-antitrypsin (SERPINA1 Human)
TagsGFP11, HA, and TagBFPExpressionBacterial and MammalianMutationE342K (ATZ mutant)Available sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRetroX GFP Mps1 DK
Plasmid#63703PurposeInducible expression of GFP-Mps1 DK fusion in mammalian cellsDepositorInsertMps1 (TTK Human)
UseRetroviralTagsEGFPExpressionMammalianMutationdeletion of aa 47-156, kinetochore binding domainPromotertight TRE promoterAvailable sinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-sfGFP(158-238)
Plasmid#220744PurposeGAL4-sfGFP(158-238) construct expression in mammlian cells.DepositorInsertGAL4-sfGFP(158-238)
ExpressionMammalianPromoterCMVAvailable sinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT Stat92E-GFP
Plasmid#126662PurposeInducible expression of Stat92E-GFP in S2 cellsDepositorInsertStat29E
ExpressionInsectAvailable sinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-EGFP-MACROD2
Plasmid#172585PurposeFor transient expression of N-terminal GFP-tagged MACROD2DepositorAvailable sinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
SBP-GFP-Tac
Plasmid#162505PurposeExpresses GFP tagged Tac in a RUSH vector in mammalian cellsDepositorAvailable sinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-N1-mSNX27-H112A
Plasmid#163619Purposemouse SNX27 cDNA with a point mutation H112A C-terminally tagged with GFPDepositorAvailable sinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG aconitase GFP
Plasmid#66104Purposeexpression of chicken aconitase GFPDepositorPublicationInsertaconitase
UseChicken expressionTagsEGFPPromoterCAGAvailable sinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
T7-His-GFP-Arp11
Plasmid#51402Purposeexpression of GFP-tagged mouse Arp11 under T7 promoterDepositorAvailable sinceMarch 5, 2014AvailabilityAcademic Institutions and Nonprofits only