We narrowed to 27,121 results for: GFP
-
Plasmid#60703Purposemammalian expression of rat Cx43 YA/VD mutant fused to GFPDepositorAvailable SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pUSE-URA3-Sec7-msYFP2
Plasmid#218969PurposeGene replacement plasmid to label S. cerevisiae Sec7 with msYFP2DepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
ssFv_lenti_wtATMSPARK2
Plasmid#195249Purposeexpress wtATMSPARK2 in a lenti vectorDepositorInsertATMSPARK2 sensor
UseLentiviralExpressionMammalianPromoterssfvAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGFP_24
Plasmid#238195PurposeEmpty lentiviral vector for expressing protein sequences fused to GFP-FTH1(24-mer), under a TRE3GV promoterDepositorTypeEmpty backboneUseLentiviralTagsGFP-FTH1(24mer) and SV40ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.ARID3a.IRES.GFP
Plasmid#169300PurposeConstitutive overexpression of human ARID3A cDNA with GFP as reporter fluorescent proteinDepositorAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
ERrefGFP1_pCDNA3
Plasmid#48635PurposeMam vector encoding for the ER targeted and FLAGM1 tagged insensitive variant of fluorescent redox probe roGFPiE with mut Cys147 to Ser, del insertion147b and mut Cys204 to Glut.Referred to as ref GFPDepositorInsertERrefGFP1
TagsFLAGExpressionMammalianMutationC147S,C204QAvailable SinceOct. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-anti-GFP(LaG17) PAGER(TF)
Plasmid#229997PurposeExpresses anti-GFP PAGER(TF) (high reversibility) in mammalian cells; used with NanoLuc-Arrestin-TEVp (Addgene #125228) and UAS-Firefly Luciferase reporter (Addgene #104840)DepositorInsertIL2SP-Aro6-LaG17-TEVcs-ALFA-KORD(RAA)-LOV-TEVcs-Gal4
UseAAVExpressionMammalianMutationV360A/R361A on KORDPromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLENTI-CMV-GFP-TREX1 delta C (aa1-235) BLAST
Plasmid#164229Purposelentiviral plasmid for GFP-hTREX1 delta C (aa1-235)DepositorInsertTREX1 (TREX1 Human)
UseLentiviralTagsGFPExpressionMammalianMutationdeleted amino acids 235-314PromoterCMVAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pARNTL.1.0-gDNA
Plasmid#112480PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ARNTLDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJUNB.1.0-gDNA
Plasmid#112409PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor JUNBDepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKin1A
Plasmid#31607DepositorAvailable SinceOct. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
CB6-GFP-TAOK2 (K57A)
Plasmid#197114PurposeExpression of kinase-deficient GFP-tagged TAOK2 (K57A) / PSK1 (K57A) in mammalian cellsDepositorInsertTAOK2 (K57A) (TAOK2 Human)
TagsGFPExpressionMammalianMutationChanged K 57 to APromoterCMVAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
LV TRE-GFP-TMD-DLL1
Plasmid#194936PurposeLV construct encoding GFP-TMD-DLL1 ligand under dox-inducible TRE promoter and containing a PGK-rtTA-M2-IRES-Puro regulator/resistance marker cassette.DepositorInserteGFP-(PDGFR)TMD-rDLL1 ICD (WT)
UseLentiviralAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP-GFP-PI4KB
Plasmid#221759PurposeStable expression of GFP-PI4KB in mammalian cellsDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP-GFP-2xFYVE
Plasmid#221750PurposeStable expression of GFP-2xFYVE in mammalian cellsDepositorInserttandem HRS FYVE domain
UseRetroviralTagsGFPExpressionMammalianMutationtwo FYVE domains (amino acids 147-223), linked by…Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC101-GFPmut2-mScarlet-I
Plasmid#208183Purposemistranslation GFP and mScarlet-I positive controlDepositorInsertsGFPmut2
mScarlet-I
UseReporterExpressionBacterialPromoterPtet+dnaK P1Available SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
CB6-GFP-TAOK1
Plasmid#197108PurposeExpression of GFP-tagged TAOK1 / PSK2 in mammalian cellsDepositorAvailable SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
H2B-2A-GFP-IRESpuro2
Plasmid#183746PurposeExpresses H2B-2A-GFPDepositorInsertH2B (H2BC16P Human)
TagsGFP with 2A protease cleavage site between H2B an…ExpressionBacterial and MammalianPromoterCMVAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Avr2-GFP pZK538
Plasmid#118011Purposeexpresses Avr2-GFP (without signal peptide) and mCherry-HDEL. Used for visualization of cell-to-cell movement of Avr2. Avr2 can be replaced with gene of interest via HiFi DNA assembly cloning (NEB) .DepositorArticleInsertsdspAvr2
mCherry
TagsEGFP and HDELExpressionBacterial and PlantPromoter35SAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only