We narrowed to 13,064 results for: LIC
-
Plasmid#118798PurposeTo test the effect of sequence on nuclear body formation and splicing of full-length TDP43DepositorAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only
-
UBQLN2_450-624W
Plasmid#176852PurposeExpresses human UBQLN2 construct 450-624 with added C-terminal W in bacterial cellsDepositorInsertUBQLN2_450C_W (UBQLN2 Human)
ExpressionBacterialMutationdeletion of residues 1-449 and addition of C-term…PromoterT7Available SinceJan. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
DDX5 D248N V5
Plasmid#199577PurposeExpresses helicase dead DDX5 cloned into pLenti puroDepositorAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHBS1505 [IBB-GFP-mCherry3E]-[BFP-TDP43 FYW-S]
Plasmid#133329PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll FYW to S in CTD of full-length TDP43Available SinceNov. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1413 GFP-TDP43 VLIM-F
Plasmid#118802PurposeTo test the effect of sequence on nuclear body formation and splicing of full-length TDP43DepositorInsertTARDBP mutant (TARDBP Human)
UseLentiviralMutationAll VLIM to F in CTD of full-length TDP43Available SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSG5-ERRbeta-delta10
Plasmid#52187PurposeExpresses human ERRbeta-delta10 splice variant in mammalian cellsDepositorInsertEstrogen-related receptor beta (ESRRB Human)
ExpressionMammalianMutationwild type sequence; codon optimized to exclude Ec…PromoterSV40Available SinceApril 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHBS1411 GFP-TDP43 FYW-S
Plasmid#118800PurposeTo test the effect of sequence on nuclear body formation and splicing of full-length TDP43DepositorInsertTARDBP mutant (TARDBP Human)
UseLentiviralMutationAll FYW to S in CTD of full-length TDP43Available SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1415 GFP-TDP43 VLIM-S
Plasmid#133323PurposeTo test the effect of sequence on nuclear body formation and splicing of full-length TDP43DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFastBacDual with LFn + PrgJ
Plasmid#84869PurposeBaculovirus Expression of LFn-PrgJ fusion. The LFn domain acts as a signal sequence that targets proteins for cytosolic translocation via the co-administered protective antigen (PA) channel proteinDepositorInsertsLFn
PrgJ
UseBaculovirusTags6xHisExpressionInsectPromoterPolyhedrinAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE:mTREK-1(K271Q)
Plasmid#133270PurposeX. laevis expression vector. It will generate the mouse TREK-1 channelDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1) (Kcnk2 )
UseOocyte expressionMutationK271QAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE:hTRAAK(Q258K)
Plasmid#133077PurposeX. laevis expression vector. It will generate the human TRAAK channelDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1), Q258K (Kcnk2 Mouse)
MutationQ258KPromoterT7Available SinceOct. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj11
Plasmid#173139PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj11 (kcnj11 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
DsRed +9e
Plasmid#191766PurposeExpression of DsRed fused to a positively charged polypeptide (2 x KSG) . Overall charge on tetramer: +9eDepositorInsertDsRed
TagsN terminal fusion of positively charged polypetod…ExpressionBacterial and MammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHBS1412 GFP-TDP43 FYW-L
Plasmid#118801PurposeTo test the effect of sequence on nuclear body formation and splicing of full-length TDP43DepositorInsertTARDBP mutant (TARDBP Human)
UseLentiviralMutationAll FYW to L in CTD of full-length TDP43Available SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOPTXcGMPRELUC
Plasmid#68503Purposecyclic nucleotide reporter for bacteria or plant cellsDepositorInsertOPTX promoter with cGMPRE (AT1G33440 Mustard Weed)
TagsluciferaseExpressionBacterial and PlantMutation3x cGMPRE inserted 190bp 5' of ATG (cGMPRE =…PromoterOPTX promoter with cGMPREAvailable SinceSept. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHBS1398 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 G368W]
Plasmid#118811PurposeTo test the effect of sequence on TDP43 splicing activityDepositorAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
(PM-S608E)FLAG-Cep215-FL
Plasmid#106906PurposeExpresses murine phospho-mimetic CEP215 at S608DepositorInsertCEP215 (Cdk5rap2 Mouse)
TagsFLAGExpressionMammalianMutationchanged Serine-608 to Glutamic AcidPromoterCMVAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:hTRAAK(G124I)
Plasmid#130672PurposeP. pastoris expression vector. It will generate the human TRAAK channel (1-300) fused to a C-terminal GFPDepositorInsertKCNK4 (KCNK4 Human)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationN104Q, N108Q, G124IAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPTXGARE
Plasmid#68542Purposecyclic nucleotide reporter for bacteria or plant cellsDepositorInsertOPTX promoter with GARE (AT1G33440 Mustard Weed)
TagsluciferaseExpressionBacterial and PlantMutation5x GARE inserted 190 bp 5' pf ATG (GARE = ta…PromoterOPTX promoter with GAREAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pP[RS3]3'M
Plasmid#53552Purposefor an easy screen of TALEN- and CRISPR/Cas9- mediated mutagenesis in DrosophilaDepositorInsertAscI and MluI restriction enzyme sites
ExpressionInsectPromotersame pP[RS3]Available SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(cyto).cpSFGFP.HaloTag
Plasmid#244109PurposeCytosolic expression of non-responsive circularly permuted Super Folder GFPDepositorInsertcpSFGFP
UseAAVTagsHaloTagAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2
Plasmid#244111PurposeCytosolic expression of green glucose sensorDepositorInsertiGlucoSnFR2
UseAAVAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAGFLEX.(cyto).iGlucoSnFR2
Plasmid#244078PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2
UseAAVAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMTHFD1
Plasmid#217436PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human MTHFD1DepositorInsertsgRNA targeting MTHFD1 (MTHFD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLJC2-TK2-3xFLAG
Plasmid#217427PurposeLentiviral overexpression of human TK2DepositorInsertTK2 (TK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert sequence is a codon-optimized gBLOCK (IDT)PromoterCMVAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgTYMS
Plasmid#217430PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TYMSDepositorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgTK2_4
Plasmid#217431PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TK2DepositorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgTK2_5
Plasmid#217432PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TK2DepositorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgSHMT2
Plasmid#217435PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human SHMT2DepositorInsertsgRNA targeting SHMT2 (SHMT2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Nova1-GFP
Plasmid#217033PurposeOverexpression of Nova in DRG neurons promotes the "mature" splicing pattern observed in CNS neuronsDepositorAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CHyMErA_U6(SpCas9_I-SceI)-(AsCas12_PacI)_PGK-puro
Plasmid#189634PurposeLentiviral expression of single SpCas9 and AsCas12a gRNAs for generating combinatorial CHyMErA 3Cs librariesDepositorInserthU6 Cas9-Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
p11d-RPA70/14 (MSW#134)
Plasmid#208076PurposeExpression of human Replication Protein A 70 and 14-kDa subunits in E. coli with 14 having a His-tagDepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 4 CMV eGFP
Plasmid#206272PurposeENTR Vector 4 for MultiSite Gateway assembly. Encodes eGFP under the control of a CMV promoterDepositorInserteGFP
UseMultimate/gateway entr 4ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 4 CMV mTagBFP
Plasmid#206279PurposeENTR Vector 4 for MultiSite Gateway assembly. Encodes mTagBFP under the control of a CMV promoter.DepositorInsertmTagBFP
UseMultimate/gateway entr 4ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRA1SEGFPTcIfm
Plasmid#193777PurposeCassette 1: Expresses EGFP under the control of PR promoter, Cassette 2: Expresses frame-shifted CI under the control of PLTetO-1 promoter, pUC origin of replication, Ampicillin selectionDepositorInsertEGFP and frame-shifted CI in opposite orientation, controlled by separate promoters and terminators
UseSynthetic BiologyExpressionBacterialPromoterPR promoter and PLTetO-1Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTA1cI-T3
Plasmid#193789PurposeExpresses truncated version of lambda CI named T3 under the control of PLTetO-1 promoter, pUC origin of replication, Ampicillin selectionDepositorInsertTruncated version of Lambda CI, named T3, where the first two codons are deleted
UseSynthetic BiologyExpressionBacterialPromoterPLTetO-1Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
DsRed -7e
Plasmid#191765PurposeExpression of DsRed fused to a negatively charged polypeptide. Overall charge on tetramer: -7eDepositorInsertDsRed
TagsN terminal fusion of negatively charged polypetod…ExpressionBacterial and MammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj13
Plasmid#173143PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj13 (kcnj13 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj15
Plasmid#173145PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj15 (kcnj15 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj3a
Plasmid#173129PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj3a (kcnj3a Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj5
Plasmid#173132PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj5 (kcnj5 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#173133PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj6 (kcnj6 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFendoNA2S
Plasmid#174730PurposeExpresses GFP-endoNA2-S706A fusion protein for detection of polysialic acid. The endoNA2-S706A is a noncatalytic endosialidase that lacks the ability for releasing its C-terminal chaperone domain.DepositorInsertendoNA2-S706A
ExpressionBacterialMutationChanged Serine 706 to AlanineAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnma1a
Plasmid#164951PurposeZebrafish kcnma1a gene CDSDepositorInsertkcnma1a (kcnma1a Zebrafish)
UsePcr cloning vectorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHBS1506 [IBB-GFP-mCherry3E]-[BFP-TDP43 FYW-L]
Plasmid#133330PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll FYW to L in CTD of full-length TDP43Available SinceNov. 6, 2019AvailabilityAcademic Institutions and Nonprofits only