We narrowed to 13,073 results for: BASE;
-
Plasmid#23476DepositorInsertTRPM7 (TRPM7 Human)
UseGateway donor vectorMutationInsert encodes NCBI: NR_149154.2 bases 265 to 146…Available SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGP-CAG-VARNAM A122D WPRE-bGH-polyA
Plasmid#180486PurposeMammalian expression of voltage sensorDepositorInsertVARNAM A122D
ExpressionMammalianMutationA122DPromoterCAGAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_SEPT2 NCmut-14-GFP11_SEPT2 NCmut-14-GFP10
Plasmid#180357Purposemammalian co-expression of human SEPT2 NCmut fused to GFP10 and of human SEPT2 NCmut fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT2 F20D, V27DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_SEPT9_i1 NCmut-14-GFP11_SEPT9_i1 NCmut-14-GFP10
Plasmid#180358Purposemammalian co-expression of human SEPT9_i1 NCmut fused to GFP10 and of human SEPT9_i1 NCmut fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT9_i1 I281D, M288DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-pLenti-ACTA2-R179 (WT) (LLH661)
Plasmid#242682PurposePlasmid for expression of ACTA2-R179 (wild-type) cDNA from a lentiviral cassetteDepositorInsertpLenti-ACTA2-R179_cDNA
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB OROV Gc Spike H6
Plasmid#229662PurposeMake PiggyBac stable cell line expressing Oropouche virus BeAn 19991 Gc spike region (residues 482–894 of M polyprotein) with C-terminal His6 tagDepositorInsertOROV Gc spike
UsePiggybacTags6xHisExpressionMammalianMutationcontains residues 482-894 onlyPromoterTREAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP11-14-SEPT7 Gmut1_GFP10-14-SEPT7 Gmut1
Plasmid#180354Purposemammalian co-expression of human SEPT7 Gmut1 fused to GFP10 and of human SEPT7 Gmut1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 W269A, H279DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP11-14-SEPT7 Gmut1_SEPT9_i1 Gmut-14-GFP10
Plasmid#180355Purposemammalian co-expression of human SEPT9_i1 Gmut fused to GFP10 and of human SEPT7 Gmut1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 W269A, H279D and SEPT9_i1 W520A, H530DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP11-14-SEPT7 Gmut1_SEPT9_i3 Gmut-14-GFP10
Plasmid#180356Purposemammalian co-expression of human SEPT9_i3 Gmut fused to GFP10 and of human SEPT7 Gmut1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 W269A, H279D and SEPT9_i3 W502A, H512DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_SEPT9_i3 NCmut-14-GFP11_SEPT9_i3 NCmut-14-GFP10
Plasmid#180360Purposemammalian co-expression of human SEPT9_i3 NCmut fused to GFP10 and of human SEPT9_i3 NCmut fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT9_i3 I263D, M270DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-XRCC1-EGFP-T2A-Myc-POLB(K35A/K68A/K72/PAMmut)
Plasmid#176140PurposeEGFP fused to the C-terminus of XRCC1, linked by T2A to N-terminus Myc-tagged POLB with the mutations Lys35Ala, Lys68Ala, Lys72Ala, a mutation in the PAM site used by POLBKO gRNA1 & a hygromycin resisDepositorUseLentiviralTagsEGFP and MYCExpressionMammalianMutationMyc-tagged PolB with mutations Lys35 to Ala, Lys6…PromoterEF1AAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCpfSA
Plasmid#187890PurposeCRISPR/Cpf1-based Staphylococcus aureus temperature-sensitive plasmid for genome editing in Staphylococcus aureusDepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
HC-M
Plasmid#173481PurposeAn rrnB P1-based GFP ATP reporter in E. coliDepositorInsertGFP-mut2
UseSynthetic BiologyTagsssrA degradation tagExpressionBacterialPromoterrrnB P1Available SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSIP403
Plasmid#122028PurposePlasmid for expression of gene of interest in Lactobacillus plantarum and L. sakeiDepositorInsertgusA
ExpressionBacterialPromotersppAAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLp_3050sNuc
Plasmid#122030PurposePlasmid for heterologous protein secretion in Lactobacillus plantarum and L. sakeiDepositorInsertsignal peptide Lp_3050
ExpressionBacterialPromotersppAAvailable SinceNov. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfB2224
Plasmid#67547PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked kanMX marker, integration into S. cerevisiae XI-2 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Floxed-STOP mCherry
Plasmid#122963PurposemCherry-based fluorescent reporter for Cre-loxP DNA recombination reactionDepositorInsertpcDNA3.1_Floxed-STOP mCherry
UseCre/LoxExpressionMammalianPromoterCMVAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-Rncp-iGluSnFR1
Plasmid#107336PurposeRed fluorescent glutamate sensor with ncp topology. Membrane-displayedDepositorInsertRncp-iGluSnFR1
ExpressionMammalianPromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR_Gal4UAS_tBFP_PGK_mCitrine
Plasmid#188386PurposeLentiviral vector - tBFP reporter for Gal4-based SNIPRs with a constitutive mCitrine;DepositorInsertGal4UAS_tBFP_PGK_mCitrine
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only