We narrowed to 127 results for: GCaMP6f
-
Plasmid#216277PurposeAAV vector with hSynapsin promoter and LoxFAS sites for Cre-Off expression of GCaMP6f (GCaMP6f will not be expressed in neurons that express Cre recombinase)DepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman synapsin 1 (hSyn)Available SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
RabV CVS-N2c(deltaG)-GCaMP6f
Plasmid#73466PurposeExpresses GCaMP6f for calcium imagingDepositorInsertGCaMP6f
UseNeurotropic virusAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ai95(RCL-GCaMP6f) targeting vector
Plasmid#61579PurposeTarget a Cre-dependent GCaMP6-fast expression cassette to the mouse Rosa26 locusDepositorInsertCAG-LSL-GCaMP6-fast
UseCre/Lox and Mouse TargetingPromoterCAGAvailable SinceJuly 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
VV246: CoChR(C108S)-GCaMP6f-ER in fck
Plasmid#58521PurposeExpresses CoChR(C108S) fused to GCaMP6f in mammalian cellsDepositorInsertCoChR(C108S)-GCaMP6f-ER
UseLentiviralTagsGCaMP6fExpressionMammalianMutationchanged Cysteine 108 to SerinePromotera-CamKIIAvailable SinceNov. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-nullCoChR-GCaMP6f-Kv2.1
Plasmid#158758PurposeCell body-targeted GCaMP6f, under synapsin promoter: nullCoChR (the optogenetic protein CoChR mutated to have 0 current), followed by GCaMP6f and the KV2.1 motif (nullCoChR-GCaMP6f-Kv2.1).DepositorInsertnullCoChR-GCaMP6f-Kv2.1
UseAAVExpressionMammalianPromotersynapsin promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
VV247: sdChR(C138S)-TS-GCaMP6f-ER in fck
Plasmid#58522PurposeExpresses sdChR(C138S) fused to GCaMP6f in mammalian cellsDepositorInsertsdChR(C138S)-TS-GCaMP6f-ER
UseLentiviralTagsGCaMP6fExpressionMammalianMutationchanged Cysteine 138 to SerinePromotera-CamKIIAvailable SinceNov. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GCaMP6f-WPRE
Plasmid#216275PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of green fluorescent calcium indicator GCaMP6fDepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman Synapsin 1 (hSyn)Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-GCaMP6f-WPRE
Plasmid#141237PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of GCaMP6f (GCaMP6f will not be expressed in mammalian cells that express Cre recombinase)DepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterHuman elongation factor-1 alpha (EF-1 alpha)Available SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-GCaMP6f-4x128-mAGNET
Plasmid#166023PurposeExpresses GCaMP6f in CaMKII+ cells with low miRNA-128 expressionDepositorInsertGCaMP6f with 4 miR-128 binding sites
UseAAV and Mouse TargetingTagsNoneExpressionMammalianAvailable SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FLEX(frt)-GCaMP6f-WPRE
Plasmid#118273PurposepAAV vector for flippase dependent GCaMP6f expression under the control of EF1a promoterDepositorInsertGCaMP6f
UseAAVTags6xHis (N terminal on insert), T7 epitope, and Xpr…ExpressionMammalianPromoterEF1aAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-CaMKIIa-GCaMP6f-P2A-nls-dTomato
Plasmid#51087PurposeForebrain principle neuron specific expression of GCaMP6f Ca sensor and physically separate nuclear localized dTomato fluorophoreDepositorInsertGCaMP6f
UseAAVTagsP2A-nls-dTomatoExpressionMammalianPromoterCaMKIIa 1.3 kbAvailable SinceFeb. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn1-GCaMP6f-P2A-nls-dTomato
Plasmid#51085PurposeNeuronal expression of GCaMP6f Ca sensor and physically separate nuclear localized dTomato fluorophoreDepositorHas ServiceAAV Retrograde and AAV1InsertGCaMP6f
UseAAVTagsP2A-nls-dTomatoExpressionMammalianPromoterhuman Synapsin1Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-GCaMP6F
Plasmid#137123PurposeIntersectional viral expression of GCaMP6F in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-GCaMP6F
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV Cag Flex H2B Gcamp6f reverse
Plasmid#74155PurposeCalcium SensorDepositorInsertGcamp6f
UseAAVTagsH2BPromoterCAGAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-CFL-SN-P2A-GCaMP6f
Plasmid#181742PurposeAAV vector for expressing CFL-SN and GCaMP6fDepositorInsertCFL-SN-P2A-GCaMP6f
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
VV209: sdChR(C138S E154A)-TS-GCaMP6f-ER in fck
Plasmid#58524PurposeExpresses sdChR(C138S E154A) fused to GCaMP6f in mammalian cellsDepositorInsertsdChR(C138S, E154A)-TS-GCaMP6f-ER
UseLentiviralTagsGCaMP6fExpressionMammalianMutationchanged Cysteine 138 to Serine; changed Glutamate…Promotera-CamKIIAvailable SinceNov. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α-loxP-GCaMP6f-loxP-WPRE
Plasmid#233288PurposeAAV vector with EF1α promoter and Cre-Out GCaMP6f, enabling to express GCaMP6f in Cre-negative cells.DepositorInsertGCaMP6f
UseAAVPromoterEF1αAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMOS008E: Entry vector for: GCaMP6F calcium sensor (cytosolic)
Plasmid#163064PurposeEntry vector for: GCaMP6F calcium sensor (cytosolic)DepositorInsertGCaMP6F
UseGateway entry vectorAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Orco-T2A-QF2-9xQUAS-GCaMP6f-3XP3-dsRed
Plasmid#157974PurposeTemplate plasmid for inserting GCaMP reporter into the Orco gene of Aedes aegypti with CRISPR/Cas9DepositorInsertOrco
ExpressionInsectAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only