Skip to main content

We narrowed to 18,690 results for: RAN-1

Showing: 81 - 100 of 18690 results
  1. UbC-blasticidine-P2A-TETon-3G transactivator

    Plasmid
    #200191
    Purpose
    A TETon activator, which combined with the DiLiCre 2.0 plasmid, drives the expression of DiLiCre 2.0 upon doxycycline. DiLiCre 2.0 is a cre recombinase that is activated by violet light.
    Depositor
    Insert
    blasticidine - P2A - TETon-3G transactivator
    Use
    Lentiviral
    Expression
    Bacterial and Mammalian
    Promoter
    UbC
    Available Since
    Aug. 30, 2023
    Availability
    Academic Institutions and Nonprofits only
  2. pMT-ubb-Avi-Cerulean-RanGAP

    Plasmid
    #79881
    Purpose
    Ubiquitin promoter driving Avi-tagged protein containing Cerulean protein fused to the carboxy-terminal domain of avian Ran GTPase-activating protein 1 (RanGap1); flanked by Tol2 sequences
    Insert
    Cerulean protein fused to the carboxy-terminal domain of avian Ran GTPase-activating protein 1 (RanGap1) (RANGAP1 Chicken)
    Tags
    Avi
    Expression
    Bacterial
    Promoter
    Ubiquitin promoter
    Available Since
    Oct. 11, 2016
    Availability
    Academic Institutions and Nonprofits only
  3. pBactin-Nedd1-mOrange2-hCM1

    Plasmid
    #196863
    Purpose
    Expression of neural precursor cell expressed developmentally down-regulated 1 (Nedd1) fused to mOrange2 and human (h) Centrosomin motif 1 (CM1). Nedd1 targets CM1 to the centrosome to activate gamma-TuRC
    Depositor
    Insert
    Nedd1-mOrange2-hCM1 (Nedd1 Human, Rat)
    Expression
    Mammalian
    Promoter
    Chicken bactin (plus Chicken bactin intron)
    Available Since
    May 16, 2023
    Availability
    Academic Institutions and Nonprofits only
  4. pBactin-Nedd1-mOrange2-rCM1

    Plasmid
    #196861
    Purpose
    Expression of neural precursor cell expressed developmentally down-regulated 1 (Nedd1) fused to mOrange2 and rat (r) Centrosomin motif 1 (CM1). Nedd1 targets CM1 to the centrosome to activate gamma-TuRC.
    Depositor
    Insert
    Nedd1-mOrange2-rCM1 (Nedd1 Rat)
    Expression
    Mammalian
    Promoter
    Chicken bactin (plus Chicken bactin intron)
    Available Since
    May 16, 2023
    Availability
    Academic Institutions and Nonprofits only
  5. pLKO.1-TRC.mKO2_shARL4C.1

    Plasmid
    #110320
    Purpose
    TRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2
    Insert
    ARL4C (ARL4C Human, Homo sapiens)
    Use
    Lentiviral and RNAi
    Expression
    Mammalian
    Promoter
    RNA polymerase III promoter for human U6 snRNA fo…
    Available Since
    Aug. 20, 2018
    Availability
    Academic Institutions and Nonprofits only
  6. mOrange2-CENPB-N-22

    Plasmid
    #57946
    Purpose
    Localization: Nucleus/Centromeres, Excitation: 549, Emission: 565
    Depositor
    Insert
    CENPB (CENPB Human)
    Tags
    mOrange2
    Expression
    Mammalian
    Mutation
    aa 1-169 of CENPB (DNA Binding Domain)
    Promoter
    CMV
    Available Since
    Oct. 24, 2014
    Availability
    Academic Institutions and Nonprofits only
  7. mOrange2-Cx32-7

    Plasmid
    #57950
    Purpose
    Localization: Gap Junctions, Excitation: 549, Emission: 565
    Depositor
    Insert
    Cx32 (GJB1 Human)
    Tags
    mOrange2
    Expression
    Mammalian
    Promoter
    CMV
    Available Since
    Oct. 24, 2014
    Availability
    Academic Institutions and Nonprofits only
  8. pSL-1

    Plasmid
    #180422
    Purpose
    Kan resistant plasmid derived from pBTK402, a broad-host-range plasmid previously shown to replicate in multiple species of bee gut bacteria. It encodes a low level RFP promoter.
    Depositor
    Insert
    Red Chromprotein gene
    Expression
    Bacterial
    Available Since
    March 22, 2022
    Availability
    Academic Institutions and Nonprofits only
  9. PS-mOrange-Homer1-N-18

    Plasmid
    #57810
    Purpose
    Localization: Integrin/Focal Adhesions, Excitation: 548 / 634, Emission: 565 / 662
    Depositor
    Insert
    Homer1 (Homer1 Rat)
    Tags
    PS-mOrange
    Expression
    Mammalian
    Promoter
    CMV
    Available Since
    Jan. 13, 2015
    Availability
    Academic Institutions and Nonprofits only
  10. PS-mOrange2-Homer1-N-18

    Plasmid
    #57811
    Purpose
    Localization: Integrin/Focal Adhesions, Excitation: 548 / 634, Emission: 565 / 662
    Depositor
    Insert
    Homer1 (Homer1 Rat)
    Tags
    PS-mOrange2
    Expression
    Mammalian
    Promoter
    CMV
    Available Since
    Jan. 6, 2015
    Availability
    Academic Institutions and Nonprofits only
Showing: 81 - 100 of 18690 results