We narrowed to 4,483 results for: Gaa
-
Plasmid#87549PurposeExpresses NGN2, MIAT, ACTC1, and TTN gRNAs in response to combinations of Cre and Flp recombinasesDepositorInsertgRNAs targeting NGN2, MIAT, ACTC1, TTN
UseCRISPR, Cre/Lox, and Synthetic BiologyExpressionMammalianAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB1-3
Plasmid#121534PurposesgITGB1-3 sequence: GTTCAGTGAATGGGAACAACG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL3-5
Plasmid#109011PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
INCENP G3.3 gRNA
Plasmid#90712Purpose3rd generation lentiviral gRNA plasmid targeting human INCENPDepositorInsertINCENP (Guide Designation G3.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
beta4-nAChR shRNA (Beta-4.3)
Plasmid#86650Purposeexpression of shRNA targeting CHRNB4DepositorAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
GSG2 E2.1 gRNA
Plasmid#90701Purpose3rd generation lentiviral gRNA plasmid targeting human GSG2DepositorInsertGSG2 (Guide Designation E2.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
NDC80 F12.1 gRNA
Plasmid#90787Purpose3rd generation lentiviral gRNA plasmid targeting human NDC80DepositorInsertNDC80 (Guide Designation F12.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
ASF1B A3.2 gRNA
Plasmid#90534Purpose3rd generation lentiviral gRNA plasmid targeting human ASF1BDepositorInsertASF1B (Guide Designation A3.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGS1212
Plasmid#63785PurposeVector to create a cassette for homologous recombination in S. cerevisiae; adds a C-terminal eGFP Strep-tag II followed by URA3 selection markerDepositorInserteGFP-Strep-tag II followed by URA3 selection marker
UseE. coli cloning vectorTagseGFP-Strep-tag IIPromoternoneAvailable SinceApril 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
FBXO5 D4.4 gRNA
Plasmid#90687Purpose3rd generation lentiviral gRNA plasmid targeting human FBXO5DepositorInsertFBXO5 (Guide Designation D4.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
MAD2L1BP F1.1 gRNA
Plasmid#90744Purpose3rd generation lentiviral gRNA plasmid targeting human MAD2L1BPDepositorInsertMAD2L1BP (Guide Designation F1.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1/CFP sh-hUBE2N
Plasmid#246752PurposeMammalian and lentiviral expression of shRNA targeting human UBE2N (Ubc13)DepositorAvailable SinceMay 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Rabep1 shRNA 369958-CMV-FL Rabep1
Plasmid#254779PurposeRabep1 shRNA 369958 with expression of full length Rabep1 rescue in pLKO backboneDepositorAvailable SinceMay 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgDROSHA-7-hUbC-dCas9-KRAB-T2a-Puro
Plasmid#255343PurposeCRISPRi targeting DROSHADepositorInsertsgDROSHA-7
UseCRISPR and LentiviralAvailable SinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-pa-U6ac-Praf2-guides
Plasmid#254765PurposePraf2 gRNA for neutrophil specific KO in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-pa-u6ac-Vamp8-guides
Plasmid#254764PurposeVamp8 gRNA for neutrophil specific KO in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
4932 TRV2-TnpB2xSV40nls-HHreRNA4PDS
Plasmid#251821PurposeEditing Photene desaturase (PDS) genes in Nicotiana benthamianaDepositorInsertISDra2 TnpB with guide targeting NbPDS flanked by HH-HDV ribozymes
Tags2xSV40nlsExpressionPlantAvailable SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
4927 TRV2-TnpB-reRNA4PDS
Plasmid#251814PurposeEditing Photene desaturase (PDS) genes in Nicotiana benthamianaDepositorInsertISDra2 TnpB with guide targeting NbPDS with HDV at 3' end
TagsAtFDnlsExpressionPlantAvailable SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
4931 TRV2-TnpB2xSV40nls-reRNA4PDS
Plasmid#251820PurposeEditing Photene desaturase (PDS) genes in Nicotiana benthamianaDepositorInsertISDra2 TnpB with guide targeting NbPDS with HDV at 3' end
Tags2xSV40nlsExpressionPlantAvailable SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only