We narrowed to 10,983 results for: cat.1
-
Plasmid#190822PurposeFor expression of the TPR domain of human ncOGT (C467X mutation) in E.coli. The ncOGT is 6x His-tagged on its N-terminus and codon-optimized for E.coli.DepositorInsertO-GlcNAc Transferase (OGT Human)
Tags6x HisExpressionBacterialMutationC467X. Also codon optimized for expression in E.c…PromoterT7Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
RIPK1 gRNA (BRDN0001149461)
Plasmid#76532Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPKm-230
Plasmid#90499PurposepSIN - EF-1alpha - PIF3 - MTAD - IRES - PhyB - GBD, dual vector of PIF3-MTAD under EF-1 alpha promoter and PhyB-DBD under IRES promoter; See growth conditions below.DepositorInsertmito-tFD and mito-tFNR
UseLentiviralAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTER GAMMA-TUBULIN shRNA Human
Plasmid#87955Purposereduced the expression of gamma-tubulin in human cellsDepositorInsertsh gamma-tubulin (TUBG1 Human)
TagsNo-tagExpressionMammalianMutationThe protein is a sh-gamma-tubulin resistant gene.…Available SinceOct. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#2
Plasmid#107730PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001148481)
Plasmid#75499Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p2xFLAGhYAP2-WW1-mutant
Plasmid#17795DepositorInsertYes-kinase associated protein (YAP1 Human)
Tags2xFlagExpressionMammalianMutationTryptophan 199 to Alanine; Proline 202 to AlanineAvailable SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
p2xFLAGhYAP2-WW2-mutant
Plasmid#17796DepositorInsertYes-kinase associated protein (YAP1 Human)
Tags2xFlagExpressionMammalianMutationTryptophan 258 to Alanine Proline 261 to AlanineAvailable SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO NET1A-V5 WT
Plasmid#69828PurposeExpresses NET1A-V5 in mammalian cells in a doxycycline inducible mannerDepositorInsertNeuroepithelial cell-transforming gene 1 protein A (NET1 Human)
UseLentiviralTagsv5ExpressionMammalianPromoterminimal CMV promoter with tetracycline operatorAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.2/V5-DEST NET1A S46A
Plasmid#69818PurposeExpresses NET1A-V5 in mammalian cellsDepositorInsertNeuroepithelial cell-transforming gene 1 protein A (NET1 Human)
TagsV5ExpressionMammalianMutationS46APromoterCMVAvailable SinceApril 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 sgOMA1 sg2
Plasmid#244866PurposeKnockout of human OMA1DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-NIP45 delta-SLD1
Plasmid#210264PurposeInducible expression of N-terminally EGFP-tagged NIP45 delta-SLD1. Use with Flp-In T-Rex system.DepositorInsertNIP45 delta-SLD1 (delta aa 260-335) (NFATC2IP Synthetic)
TagsEGFPExpressionMammalianMutationdelta-SLD1PromoterCMV/TetO2Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-NIP45 D394R
Plasmid#210265PurposeInducible expression of N-terminally EGFP-tagged NIP45 D394R resistant to siRNA. Use with Flp-In T-Rex system.DepositorInsertNIP45 D394R siRES (NFATC2IP Synthetic)
TagsEGFPExpressionMammalianMutationD394R, siRESPromoterCMV/TetO2Available SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-NIP45 delta-N1
Plasmid#210268PurposeInducible expression of N-terminally EGFP-tagged NIP45 delta-N1 resistant to siRNA. Use with Flp-In T-Rex system.DepositorInsertNIP45 delta-N1 (aa 208-419) siRES (NFATC2IP Synthetic)
TagsEGFPExpressionMammalianMutationdelta-N1, siRESPromoterCMV/TetO2Available SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-NIP45 delta-N2
Plasmid#210269PurposeInducible expression of N-terminally EGFP-tagged NIP45 delta-N2 resistant to siRNA. Use with Flp-In T-Rex system.DepositorInsertNIP45 delta-N2 (aa 261-419) siRES (NFATC2IP Synthetic)
TagsEGFPExpressionMammalianMutationdelta-N2, siRESPromoterCMV/TetO2Available SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-NIP45 D394R
Plasmid#210267PurposeInducible expression of N-terminally mCherry-tagged NIP45 D394R resistant to siRNA. Use with Flp-In T-Rex system.DepositorInsertNIP45 D394R siRES (NFATC2IP Synthetic)
TagsmCherryExpressionMammalianMutationD394R, siRESPromoterCMV/TetO2Available SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet-6xHis-TEV-Nsp8(76-198)
Plasmid#201024PurposeBacterial expression of codon optimized SARS-CoV-2 nsp8 residues 76-198, with an N-terminus His tag followed by a TEV cleavage site.DepositorInsertnon-structural protein 8 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Synthetic)
Tags6xHis-TEVExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBridge-tyrosinase.σ3A
Plasmid#197513PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-3 σ3A fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-3 σ3A
TagsGAL4-DNA binding domain fragment, HA tag, and nuc…ExpressionYeastMutationsilent substitution in codon 2 of tyrosinase tail…PromoterADH1 and MET25Available SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral FL-15A
Plasmid#113011PurposeFor bacterial expression of MBP fusion of full-length Drosophila Tral with phosphomutations (15A)DepositorInsertfull length tral (tral Fly)
ExpressionBacterialMutation15 PNG phosphorylation sites mutated to AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only