We narrowed to 10,427 results for: UTY
-
Plasmid#134731PurposeLentiviral expression vector for constitutively active dominant-negative HSF1 fused to DHFR destabilized domainDepositorInsertDHFR.dn-cHSF1 (HSF1 Human)
UseLentiviralTagsDHFRExpressionMammalianMutationDeletion of amino acids 186-202, 379−529PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
CCR5-SZ218a QTY
Plasmid#162444PurposeExpression in E coli and perform ligand binding in solutionDepositorInsertC-C chemokine receptor type 5 (CCR5 Human)
Tagshis-tagExpressionBacterialMutationAll L, I, V, F in the transmembrane region mutate…AvailabilityAcademic Institutions and Nonprofits only -
CCR5-SZ190b QTY
Plasmid#162445PurposeExpression in E coli and perform ligand binding in solutionDepositorInsertC-C chemokine receptor type 5 (CCR5 Human)
Tagshis-tagExpressionBacterialMutationAll L, I, V, F in the transmembrane region mutate…AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/GFP4_Seq1.3
Plasmid#206136PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1 (Col1a1 Mouse)
ExpressionMammalianAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet_Seq1.3
Plasmid#206137PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1 (Col1a1 Mouse)
ExpressionMammalianAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-EF1A>Tet3G:IRES:Neo
Plasmid#198756PurposeVector encodes a Tet-On Advanced transactivator under control of a constitutive EF1α promoter and confers resistance to the antibiotic G418DepositorInsertTet3G, IRES, Neo
UseLentiviralPromoterEF1AAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-hCCND1-HA
Plasmid#174154PurposeLentiviral vector expressing HA-tagged human cyclin D1DepositorInsertCCND1 (CCND1 Human)
UseLentiviralTagshemagglutinin (HA)ExpressionMammalianPromoterEF1AAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.VSVg_NGFR
Plasmid#158241PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV.CAP-B10
Plasmid#175004Purposenon-standard AAV2 rep-AAV.CAP-B10 cap plasmid with AAV cap expression controlled by a tTA-TRE amplifcation systemDepositorInsertSynthetic construct isolate AAV.CAP-B10 VP1 gene
UseAAVExpressionMammalianMutation7 amino acid substitution between VP1 452 and VP1…Promoterp41Available SinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZ M2rtTA_CAGG TetON-Sox10
Plasmid#115240PurposeRMCE donor vector for inducible expression of SOX10 constitutive expression of m2rtTA (generated from plasmid #112668)DepositorInsertSOX10 (SOX10 Human)
ExpressionMammalianAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX313-TP53-WT
Plasmid#118014PurposeConstitutive expression of wild-type human Tumor Protein p53 (TP53)DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-shRPS6
Plasmid#125780Purposeconstitutive expression of a short-hairpin RNA targeting human RPS6 (RNAi positive control)DepositorInsertshRPS6 (RPS6 Human)
UseRNAiAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.HA.RUNX1C.IRES.dTomato.PGK.sfGFP.P2A.Tet3G
Plasmid#181978PurposeHuman RUNX1C gene overexpressionDepositorAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-pGC-A
Plasmid#186626PurposepFastBac1 (baculovirus polyhedrin promoter) encoding HA signal peptide, TEV-protease cleavable His10-tag, and full-length human pGC-A (NP_000897.3 amino acids 33-1061; expression-optimized DNA)DepositorInsertNPR1 (NPR1 Human)
Tagshemagglutinin (HA) signal peptide + His10-tag + T…ExpressionInsectMutationdeleted amino acids 1-32PromoterpolyhedringAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV.CAP-B22
Plasmid#175005Purposenon-standard AAV2 rep-AAV.CAP-B22 cap plasmid with AAV cap expression controlled by a tTA-TRE amplifcation systemDepositorInsertSynthetic construct isolate AAV.CAP-B22 VP1 gene
UseAAVExpressionMammalianMutation7 amino acid substitution between VP1 452 and VP1…Promoterp41Available SinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
RMCE K>R DNA-PKcs
Plasmid#233917PurposeLow copy number provides expression of human DNA-PKcs with a single K>R substitution that ablates kinase activity.DepositorInserthuman DNA-PKcs kinase inactive mutant K3753>R (PRKDC Human)
ExpressionMammalianMutationK3753RAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-enAsCas12a(E174R/S542R/K548R)-NLS(nuc)-3xHA (AAS848)
Plasmid#107941PurposeMammalian expression plasmid for human codon optimized enAsCas12a (enhanced AsCas12a) encoding E174R/S542R/K548R substitutionsDepositorInserthuman codon optimized enAsCas12a (E174R/S542R/K548R)
Tags3x HA and NLS (nucleoplasmin)ExpressionMammalianMutationE174R, S542R and K548RPromoterCAGAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-CR-NENF-C-TAP
Plasmid#128511PurposeLentiviral constitutive expression of CRISPR-resistant NENF with c-terminal FLAG and HA tag.DepositorInsertNENF (NENF Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationSynonymous silent mutations to F81, Y82, G83 and …PromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2234)
Plasmid#160628PurposeModule for the constitutive expression of the nptII, Cas9 and DsRed genes.DepositorInserttNos:nptII:PNos-P35s:Cas9:tNos-P35s:DsRed:tNos
UseCRISPRMutationBsaI and BsmBI sites removedPromoterPnos, 35S, 35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only