We narrowed to 24,181 results for: CRISPR
-
Plasmid#172833PurposeMammalian expression of a sgRNA targeting the intron 1of rat Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of rActb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_rSyn1 sgRNA / hSpCas9
Plasmid#172840PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of rSyn1 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of rSyn1 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSHS273 - Bacterial expression plasmid for SpCas9∆REC3 variant
Plasmid#101202PurposeBacterial expression plasmid for SpCas9∆REC3 variantDepositorInsertSpCas9 variant M1–N497,GGS,V713–D1368
Tags10x His, MBP, and TEV siteExpressionBacterialMutationM1–N497, GGS, V713–D1368PromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-GFP (gRNA: Ascl1-3)
Plasmid#159658PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting mouse Ascl1.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-GFP (gRNA: Ascl1-2)
Plasmid#159657PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting mouse Ascl1.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJSC228 - Bacterial expression plasmid for SpCas9 Cluster 2 variant
Plasmid#101233PurposeBacterial expression plasmid for SpCas9 Cluster 2 variantDepositorInsertSpCas9 variant G582A/V583A/E584A/D585A/N588A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationG582A, V583A, E584A, D585A and N588APromoterT7Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hNmeCas9-NLS(SV40)-3xFLAG (KAC409)
Plasmid#133790PurposeCAG promoter expression plasmid for human codon optimized NmeCas9 nuclease with C-terminal NLS (SV40)DepositorInserthuman codon optimized NmeCas9
TagsNLS(SV40)-3xFLAGExpressionMammalianMutationn/aPromoterCAGAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-Aa3.8.4
Plasmid#136375PurposeGateway entry clone for AaCas12b sgRNA expression under ZmUbi promoter with ribozyme processing; sgRNA scaffold 3.8 with MS2 at the third stem loop is usedDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pJSC272 - Bacterial expression plasmid for SpCas9 Cluster 5 + Q926A variant
Plasmid#101236PurposeBacterial expression plasmid for SpCas9 Cluster 5 + Q926A variantDepositorInsertSpCas9 variant K918A/V922A/R925A/Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationK918A, V922A, R925A and Q926APromoterT7Available SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pFETCh_ARID4B
Plasmid#101072PurposeDonor vector for 3' FLAG tag of human ARID4BDepositorAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGabrg3
Plasmid#124858PurposeMutagenesis of Gabrg3DepositorInsertGabrg3 (Gabrg3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGrin2a
Plasmid#124863PurposeMutagenesis of Grin2aDepositorInsertGrin2a (Grin2a Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGria3
Plasmid#124869PurposeMutagenesis of Gria3DepositorInsertGria3 (Gria3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGabrg3
Plasmid#124872PurposeMutagenesis of Gabrg3DepositorInsertGabrg3 (Gabrg3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGabrg2
Plasmid#124871PurposeMutagenesis of Gabrg2DepositorInsertGabrg2 (Gabrg2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only