We narrowed to 10,428 results for: UTY
-
Plasmid#125777Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgMLH1-2 (MLH1 Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
PBRPyCAG-LoxP-ERAS-STOPcassette-Loxp-DsRed-IRES-PURO
Plasmid#52419PurposeConstitutive mammalian expression of ERAS. Upon CRE mediated deletion of ERAS insert, dsRED expression markers is truned on due to concomittant removal of stop cassette.DepositorInsertERAS (ERAS Human)
PromoterCAGGSAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-beta-5 in pcDNAI/Amp
Plasmid#55763PurposeA carboxyl-terminal CFP fragment was fused to Gbeta-5. When co-expressed with an amino terminal CFP or YFP fragment fused to a Ggamma subunit or RGS7, a fluorescent signal is produced.DepositorInsertCFP(159-238)-beta-5 (GNB5 Human, Aequorea victoria)
TagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-NTID194-GSQ-PMLiva3MAS-P2A-BLAST
Plasmid#208039PurposeEnables constitutive expression of N-terminal Split-TurboID-fused PML (isoform IVa; 3MAS mutant; K>R sumoylation sites, mutated SIM); selection with blasticidinDepositorInsertPML (isoform IVa; 3MAS) (PML Human)
UseLentiviralTagsFLAG, N-terminal Split-TurboIDMutation3MAS mutant: K65R, K160R and K490R; mutated SIMPromoterEFSAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN-EIJ
Plasmid#125774Purposeconstitutive expression of a guide RNA targeting an exon-intron junction of human WRNDepositorInsertsgWRN-EIJ (WRN Human)
UseCRISPRAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLIK_hygro_p53(R280K)_V5
Plasmid#136540PurposeLentiviral expression vector for an inducible p53(R280K)-V5DepositorInsertp53(R280K) (TP53 Human)
UseLentiviral; Destinatioin vector for gateway cloni…TagsV5ExpressionMammalianMutationp53(R280K)V5 was cloned from pLenti6-p53-R280K-V5…Available SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgPOLR2D
Plasmid#125769Purposeconstitutive expression of a guide RNA targeting human POLR2D (CRISPR positive control)DepositorInsertsgPOLR2D (POLR2D Human)
UseCRISPRAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/hFGFR3-K650M-V5
Plasmid#214909Purposeexpression of the K650M mutant variant of human FGFR3, which is associated with Severe Achondroplasia with Developmental Delay and Acanthosis Nigricans (SADDAN)DepositorInsertFGFR3 (FGFR3 Human)
TagsV5/HisExpressionMammalianMutationK650M substitutionPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-2P-N317P
Plasmid#196378PurposeMammalian cell expression of SARS-CoV-2 Spike protein with mutation N317P with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-2P-N317P (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN_TTmiRc2_p53(R280K)_V5
Plasmid#136525PurposeUsed as a donor vector to clone into pSLIKDepositorInsertp53(R280K) (TP53 Human)
UseEntry vector for gateway cloningTagsV5Mutationp53(R280K)V5 was cloned from pLenti6-p53-R280K-V5…AvailabilityAcademic Institutions and Nonprofits only -
pT2-shATRX-GFP
Plasmid#124259PurposeExpresses shRNA targeting ATRX with a GFP reporter which is driven by the SV40 promoter. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshATRX
ExpressionMammalianAvailable SinceJuly 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgPlxnb2-2 in pT4-U6-sgRNA-CMV-EGFP
Plasmid#239589Purposeexpresses guide#2 to boost the expression of mouse Plxnb2, via CRISPRaDepositorInsertsgRNA targeting TSS-upstream reagion of Plxnb2 (Plxnb2 Mouse)
UseSleeping beauty (sb) transposonExpressionMammalianPromoterhU6Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgPlxnb2-3 in pT4-U6-sgRNA-CMV-EGFP
Plasmid#239590Purposeexpresses guide#3 to boost the expression of mouse Plxnb2, via CRISPRaDepositorInsertsgRNA targeting TSS-upstream reagion of Plxnb2 (Plxnb2 Mouse)
UseSleeping beauty (sb) transposonExpressionMammalianPromoterhU6Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgPlxnb2-1 in pT4-U6-sgRNA-CMV-EGFP
Plasmid#239588Purposeexpresses guide#1 to boost the expression of mouse Plxnb2, via CRISPRaDepositorInsertsgRNA targeting TSS-upstream reagion of Plxnb2 (Plxnb2 Mouse)
UseSleeping beauty (sb) transposonExpressionMammalianPromoterhU6Available SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFSp-GFP-YAP (5SA)
Plasmid#174170PurposeLentiviral vector to constitutively express overactive YAP (5 LATS phosporylation sites mutated to Ala) under control of the EFS promoter.DepositorInsertYAP (YAP1 Human)
UseLentiviralTags3x FLAG tagExpressionMammalianMutationFive LATS phosphorylation sites (S61, S109, S127,…PromoterEFSAvailable SinceSept. 28, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV[TetOn]-Puro-TRE3G>mNeurog2
Plasmid#198754PurposeVector encodes the gene for murine neurogenin-2 under control of a Tet-controlled promoter and the puromycin resistance gene under control of a constitutive PGK promoterDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
PGKp-GFP-YAP (5SA)
Plasmid#174174PurposeLentiviral vector to constitutively express overactive YAP (5 LATS phosporylation sites mutated to Ala) under control of the human PGK promoter.DepositorInsertYAP (YAP1 Human)
UseLentiviralTags3x FLAG tagExpressionMammalianMutationFive LATS phosphorylation sites (S61, S109, S127,…PromoterPGKAvailable SinceAug. 19, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAG-denAsCas12a(E174R/S542R/K548R/D908A)-NLS(nuc)-3xHA-VPR (RTW776)
Plasmid#107943PurposeMammalian expression plasmid for human codon optimized DNase-inactive enAsCas12a (enhanced AsCas12a) fused to the VPR activation domain, encoding E174R/S542R/K548R/D908A substitutionsDepositorInserthuman codon optimized DNase-inactive (D908A) enAsCas12a (E174R/S542R/K548R) fused to VPR activation domain
Tags3x HA, NLS (nucleoplasmin), and VPR (VP64-p65-Rta…ExpressionMammalianMutationE174R, S542R, K548R and D908APromoterCAGAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-M1-di-Ub(G76V)-HOIL-1
Plasmid#229539PurposeConstitutively active M1-di-ubiquitin HOIL-1 fusion protein for expression in E. coliDepositorTags6xHis-3CExpressionBacterialMutationChanged Gly 76 to Val and changed Gly 76 to ValPromoterT7Available SinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only