We narrowed to 15,978 results for: grna
-
Plasmid#27995PurposeRetroviral transfer plasmid for Tet-regulated shRNA expression with a TREtight promoter. Contains DsRed2 and Venus fluorescent reporters.DepositorInsertTtRMPVIR (shRen)
UseRNAi and Retroviral; Fluorescent reportersExpressionMammalianAvailable SinceMarch 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSF280
Plasmid#167675PurposeIntermediate vector for six gRNAs using GoldenGate, contains ccdB and attL1-L2 sites for GatewayDepositorInsertattL1-ccdB-attL2
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
5aa SunTag VP64 CLV3
Plasmid#115485PurposeCRISPR-Cas9 SunTag system to target VP64 to the CLV3 locus with two guide RNAsDepositorInsertg2_U6_g1_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_2xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-SMG6-CDS-1
Plasmid#136046PurposeSMG6 shRNA (Targeting CDS #1) inserted into the PLKO.1 plasmid (AACTTGTAAGTAACCTGCAGC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-SMG6-CDS-2
Plasmid#136047PurposeSMG6 shRNA (Targeting CDS #2) inserted into the PLKO.1 plasmid (AAGGAGTTCCAGGTGTTACTG)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
5aa SunTag VP64 AP3
Plasmid#115484PurposeCRISPR-Cas9 SunTag system to target VP64 to the AP3 locus with two guide RNAsDepositorInsertg2_U6_g1_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_2xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132-tRNA
Plasmid#179211PurposeGolden Gate entry vector; 2nd gRNA with tRNADepositorTypeEmpty backboneUseCRISPRPromoterno promoterAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
BlatCas9
Plasmid#163792PurposeThe plasmid expresses human codon-optimized BlatCas9 and gRNA expression elements.DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMD19-Cas9_handle-S.pyogenes_terminator-PBBa_J23117-Cmr
Plasmid#190794PurposeTemplate vector to amplify pieces for creating multiplex sgRNA-arrays.DepositorInsertsgRNA-scaffold only
UseSynthetic BiologyExpressionBacterialPromoterBBa_J23117Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P4 TaU6 guide acceptor
Plasmid#165600PurposeGoldenGate (MoClo) Level 1 Position 4 TaU6 guide acceptor plasmidInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P3 TaU6 guide acceptor
Plasmid#165599PurposeGoldenGate (MoClo) Level 1 Position 3 TaU6 guide acceptor plasmidInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Rheb1 shRNA #1
Plasmid#26625DepositorAvailable SinceOct. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLKO-sh-hSC
Plasmid#46896Purposeexpression of scrambled shRNADepositorInsertscrambled
UseLentiviral and RNAiExpressionMammalianAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v2 sgATG7
Plasmid#211534PurposeDeletes ATG7DepositorInsertsgATG7
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
px459 VQR
Plasmid#101715PurposesgRNA/Cas9 expression plasmid with Cas9 VQR mutations (NGA PAM)DepositorInsertSpCas9 VQR
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVQR (D1135V, R1335Q and T1337R)Available SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
LTR5HS S. aureus scaffold CARGO array
Plasmid#191317PurposeContains an array of guide RNAs targeting LTR5Hs elementsDepositorInsertArray of guide RNAs
UseCRISPRTagsmCherryExpressionMammalianAvailable SinceNov. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-S12
Plasmid#84031PurposeTo episomally express codon optimized Cas9 and chimeric guide RNADepositorInsertshSpCas9
eGFP
Tags3x FLAGExpressionMammalianPromoterCMV and CMV (downstream of F2A self-cleaving pept…Available SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVTH-sip53
Plasmid#12239DepositorAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSF279
Plasmid#167674PurposeIntermediate vector for five gRNAs using GoldenGate, contains ccdB and attL1-L2 sites for GatewayDepositorInsertattL1-ccdB-attL2
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Rheb1 shRNA #2
Plasmid#26626DepositorAvailable SinceNov. 17, 2010AvailabilityAcademic Institutions and Nonprofits only