We narrowed to 13,184 results for: BASE
-
Plasmid#101337PurposeRepaired U3 allows LTR-based transcription by the provirus with GFP as a marker for expression. WPRE was deleted.DepositorInsertGFP
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBRC169
Plasmid#79670PurposeDsREDmonomer-based BiFC vector for transient expression of RC (169-225) in plants.DepositorTypeEmpty backboneUseReporter plasmidTagsDsRED-monomer (169–225)/RC169ExpressionPlantPromoterCaMV35SAvailable SinceAug. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2190
Plasmid#67535PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked KlLEU2 marker, integration into S. cerevisiae XI-2 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2193
Plasmid#67542PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked natMX marker, integration into S. cerevisiae X-2 chromosomal location, USER site for cloning, amp resistance.DepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-puro-OsAID (p5109)
Plasmid#239359PurposepPOTv7 based plasmid template for addition of a Rice Auxin Inducible Degradation (AID) domain to genes in trypanosomes with selection using puromycinDepositorInsertRice Auxin Inducible Degradation domain
UseBacterialPromoternoneAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-MDC1
Plasmid#207108PurposepHTN HaloTag CMV-neo (Promega; #G7721) based vector to express HaloTag-MDC1 in human cells.DepositorInsertHaloTag-MDC1
TagsHaloTagExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-MRPL50-VC155
Plasmid#182373PurposemVenus-based mito-riboBiFC vector (Negative control)DepositorAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKF-D2irTNP2AG-T2APuroR-5kwh
Plasmid#128255PurposeMammalian linearizer gene circuit based on negative feedback in a Flp-In expression system controlling the PuroR gene.DepositorInserthTetR::P2A::EGFP::T2A::PuroR
UseSynthetic Biology; Flp-in expression vectorExpressionMammalianPromoterCMV-D2ir promoterAvailable SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFH92
Plasmid#125820PurposeLevel0 nScCas9-ABE7.10, wheat/human codon optimizedDepositorInsertnScCas9-ABE7.10, wheat/human codon optimized
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pScaf-5544.4
Plasmid#111524PurposepScaf phagemid with insert for generating DNA origami scaffold 5544 bases in length (v4)DepositorInsertpScaf-KH'
ExpressionBacterialAvailable SinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pScaf-8064.4
Plasmid#111520PurposepScaf phagemid with insert for generating DNA origami scaffold 8064 bases in length (v4)DepositorInsertpScaf-8064.4
ExpressionBacterialAvailable SinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-Puro-U6-gRNA-pA plasmid
Plasmid#247671PurposespCas9 gRNA is driven by human U6 promoter, with the gRNA cassette between PuroR and pA, making it detectable in polyA-based RNA-seq.DepositorInsertPuromycin resistant gene
ExpressionMammalianPromoterTK promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pROS10
Plasmid#107924PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL16
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSETb MGlucoMeter2.6-15u
Plasmid#247469PurposeMatryoshka-based Glucose SensorDepositorInsertGlucose Binding Protein (GBP) with Matryoshka dual fluorophore cassette
ExpressionBacterialAvailable SinceFeb. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRSETb MGlucoMeter2.6-7m
Plasmid#247472PurposeMatryoshka-based Glucose SensorDepositorInsertGlucose Binding Protein (GBP) with Matryoshka dual fluorophore cassette
ExpressionBacterialAvailable SinceFeb. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
FusX DdCBE DddA6 1397N
Plasmid#221934PurposeBackbone plasmid for FusX-based assembly of DdCBE arm with DddA6 1397NDepositorTypeEmpty backboneUseSynthetic BiologyTags3xFLAGMutationDddA: Q1310R, S1330I, T1380IAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
FusX DdCBE DddA11 1397N
Plasmid#221935PurposeBackbone plasmid for FusX-based assembly of DdCBE arm with DddA11 1397NDepositorTypeEmpty backboneUseSynthetic BiologyTags3xFLAGMutationDddA: S1330I, A1341V, N1342S, E1370K, T1380IAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only