We narrowed to 1,704 results for: pyogenes Cas9
-
Plasmid#167688PurposeFinal destination vector for single Gateway LR reactionDepositorInsertpEC1.2::Cas9i
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU323
Plasmid#167690PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUBQ4-2::Cas9i
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU292
Plasmid#167687PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUBQ4-2::Cas9i
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU52
Plasmid#167678PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::spCas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU51
Plasmid#167677PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::spCas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 RFP670
Plasmid#187646Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning siteDepositorInsertRFP 670
UseLentiviralTagsRFP670 and sgRNA cloning siteExpressionMutationPromoterEFS (P2A)Available sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…PromoterAvailable sinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0202
Plasmid#185626PurposeMoClo Level 1, position 5 reverse, transcriptional unit for expression of plant codon optimized Cas9 from Streptococcus pyogenes driven by 35S promoterDepositorInsertSpCas9
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0001
Plasmid#185625PurposeMoClo Level 1, position 2 reverse, transcriptional unit for expression of plant codon optimized Cas9 from Streptococcus pyogenes driven by 35S promoterDepositorInsertSpCas9
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSc1
Plasmid#80436PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRTagsExpressionMammalianMutationPromoterCMV and U6Available sinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSc2
Plasmid#80437PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRTagsExpressionMammalianMutationPromoterCMV and U6Available sinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJH375
Plasmid#86841Purposemamalian expression of anti-CRISPR protein AcrIIA3DepositorInsertacrIIA3
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-Universal
Plasmid#52694PurposeThis plasmid can be used to mutate genes in Toxoplasma gondii using the CRISPR/Cas9 system after having an appropriate protospacer cloned into it.DepositorInsertsCas9
Toxoplasma U6 upstream region - protospacer cloning sequence - chiRNA
UseCRISPR; Toxoplasma gondiiTags3X FLAG and Nuclear localization signalExpressionMutationPromoterTgTUB1 and Toxoplasma U6Available sinceJune 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pT7sgRNA
Plasmid#111820PurposeExpresses sgRNA in T. brucei cellsDepositorInsertsgRNA
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSW24
Plasmid#86837Purposebacterial expression of anti-CRISPR protein AcrIIA3DepositorInsertacrIIA3
UseTagsExpressionBacterialMutationPromoteraraBADAvailable sinceOct. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
C113m
Plasmid#121012PurposeMoClo golden gate assembly CD part for Cas9 (S. pyogenes gRNA-targeted endonuclease Cas9). Please see Supplemental Documents for annotated Genbank file.DepositorInsertCas9
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAS1yl
Plasmid#73226PurposeConstitutive expression of Cas9 and sgRNA in Yarrowia lipolytica cellsDepositorInsertsCas9
sgRNA
UseCRISPR; In y. lipolyticaTagsExpressionBacterialMutationPromoterunknownAvailable sinceJune 16, 2016AvailabilityAcademic Institutions and Nonprofits only