We narrowed to 14,449 results for: RING;
-
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
mC4-GFP
Plasmid#221339PurposeExpresses murine homolog of complement 4 fused with GFP under CAG promoterDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-1
Plasmid#177781PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-2
Plasmid#177782PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-ΔSEMA
Plasmid#190647PurposeExpresses Mouse Sema7A with SEMA domain deletedDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-ΔIG
Plasmid#190648PurposeExpresses Mouse Sema7A with IG Domain DeletedDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-ΔPSI
Plasmid#190649PurposeExpresses Mouse Sema7A with PSI domain deletedDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-KCE
Plasmid#190651PurposeExpresses Mouse Sema7A with RGD motif mutated to KCEDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-sp-myc-hSema4D
Plasmid#190654PurposeExpresses Human Sema4D with N terminal myc after signal peptideDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ Zf nhsl1b-mNeongreen
Plasmid#233883PurposemNeongreen tagged form of zebrafish nhsl1b. For in vitro transcription (SP6) or expression through CMV.DepositorInsertnhsl1b (nhsl1b Zebrafish)
UseIn vitro synthesis of mrnaTagsmNeongreenExpressionMammalianAvailable SinceJuly 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-fDIO(SERT-HA)-3xmiR122-WPRE-HGHpA
Plasmid#220937PurposeFLP-dependent serotonin transporter overexpression vector for non-invasive gap junction tracingDepositorAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW375 (PB) (ZNF35/IKZF1tar-6bp spacers)x4-H2B-BFP insul CMV-TO-GFP-deimlink-NZF
Plasmid#236177PurposePiggyBac-integrated plasmid containing hygromycin resistance gene, ZNF35/IKZF1-driven BFP, and GFP-NZF dummy transcription factorDepositorInsertsTagsmTagBFP2ExpressionMammalianPromoterCMV and four ZNF35/IKZF1 sitesAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW371 (PB) (ZNF35/ZNF35tar-6bp spacers)x4-H2B-BFP insul CMV-TO-ZNF35(5-8)-ZNF35(5-8)-deimlink-NZF
Plasmid#236173PurposePiggyBac-integrated plasmid containing hygromycin resistance gene, ZNF35/ZNF35-driven BFP, and ZNF35/ZNF35-NZF transcription factorDepositorInsertsTagsmTagBFP2ExpressionMammalianPromoterCMV and four ZNF35/ZNF35 sitesAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW370 (PB) (ZNF35/ZNF250tarv3-6bp spacers)x4-H2B-BFP insul CMV-TO-ZNF35(5-8)-ZNF250(1-4)-deimlink-NZF
Plasmid#236172PurposePiggyBac-integrated plasmid containing hygromycin resistance gene, ZNF35/ZNF250-driven BFP, and ZNF35/ZNF250-NZF transcription factorDepositorInsertsTagsmTagBFP2ExpressionMammalianPromoterCMV and four ZNF35/ZNF250 sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW373 (PB) (ZNF35/ZNF250tarv3-6bp spacers)x4-H2B-BFP insul CMV-TO-GFP-deimlink-NZF
Plasmid#236175PurposePiggyBac-integrated plasmid containing hygromycin resistance gene, ZNF35/ZNF250-driven BFP, and GFP-NZF dummy transcription factorDepositorInsertsTagsmTagBFP2ExpressionMammalianPromoterCMV and four ZNF35/ZNF250 sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW489 CMV-TO-ZNF35(5-8)-ZNF250(1-4)-(GGS)x8[G2V G4W S6L G7L G10W G11D G13L G17M G19I G22M G23Q S24Q]-FKBP (FLP-IN)
Plasmid#236147PurposePlasmid encoding the ZNF35/ZNF250 zinc finger array attached by a deimmunized linker to FKBP1A, under control of CMV promoter with two TetR binding sitesDepositorInsertZNF35(5-8)-ZNF250(1-4)-deImmunLink-FKBP
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only