We narrowed to 23,291 results for: ica;
-
Plasmid#110965PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertEF-hand calcium binding domain containing protein, putative (PF3D7_1463900 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
GAP50-COMP-blac-flag-his
Plasmid#110956PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsecreted acid phosphatase (GAP50) (PF3D7_0918000 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET19pps-EndoIV(Thermus Thermophilus)
Plasmid#236048PurposepET19pps-APE1(Thermus Thermophilus)DepositorInsertEndo IV from Thermus thermophilus
TagsHis tag and Histidine tagExpressionBacterialPromoterT7 RNA polymeraseAvailable SinceAug. 1, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
PX459-CTNNA1(α-catenin CRISPR KO)
Plasmid#229708PurposeKnockout of a-catenin in mammalian cells using CRISPR-Cas9 technologyDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninA+ΔβH
Plasmid#229704PurposeTransient expression of GFP-alpha-cateninA+deltabetaH in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-GtACR2-P2A-Voltron2ST-W3SL
Plasmid#217676PurposeAAV-mediated, Cre-dependent co-expression of GtACR2 and soma-targeted Voltron2 (ORCHID) for assessing inhibitory receptor driving force through voltage imaging with concurrent activation of GtACR2.DepositorHas ServiceAAV1InsertGtACR2-P2A-Voltron2ST
UseAAVTagsSoma targeting sequence (Kv2.1) on Voltron2 gene …ExpressionMammalianPromoterEF‐1αAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pME463
Plasmid#238103PurposeExpressed ME-ABE ABE7.10-HK with SpRYCas9DepositorInsertTadA*7.10(Y123H/N157K)-m_SpRYnCas9(D10A)
UseCRISPRTagsSV40 bpNLS and SV40 bpNLS-P2A-mCherryExpressionMammalianMutationTadA modifications include Y123H, N157K; SpRY-nCa…Available SinceJan. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLViN-iRFP670-α-cateninA+ΔβH
Plasmid#229707PurposeLentiviral expression of iRFP670-alpha-cateninA+delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiMutB3GALT5-blast
Plasmid#208381Purposelentiviral vector for expressing human B3GALT5 with C-terminal myc-DDK tag, includes nucleotide change in PAM targeting sequenceDepositorInsertbeta-1,3-galactosyltransferase 5 (B3GALT5 Human)
UseLentiviralTagsmyc, FLAGExpressionMammalianMutationnucleotide change in PAM targeting sequence nt 51…PromoterEF-1 alpha core promoterAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiMutB3GALT5catdead-blast
Plasmid#220869Purposelentiviral vector for expressing human B3GALT5 with D156A and D243A inactivating mutations and C-terminal myc-DDK tag, includes nucleotide change in PAM targeting sequenceDepositorInsertbeta-1,3-galactosyltransferase 5 (B3GALT5 Human)
UseLentiviralTagsmyc, FLAGExpressionMammalianMutationencodes D156A and D243A mutations; also, nucleoti…Available SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-pDUXChd:hDUX4ctd-ca
Plasmid#198237PurposeLentivector with tet-inducible porcine DUXC/human DUX4 chimera (codon altered)DepositorInsertDUX4L pDUXChd:hDUX4ctd (codon altered) (DUX4 Human, S. scrofa (porcine))
UseLentiviralExpressionMammalianMutationcodon alteredPromoterTREAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H170
Plasmid#170352PurposemTurq2Del_EPACdDEPCD_cp173Ven(ST)_Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmTurq2Del_EPACdDEPCD_cp173Ven(ST)_Ven(ST) (RAPGEF3 Human)
UseAdenoviralExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSHDY*in_PpetE:BCD2:MrBBS:Strep
Plasmid#133973PurposeHeterologous, copper-inducible expression of (-)-α- bisabolol synthase from Matricaria recutita (MrBBS) in Synechocystis sp. PCC 6803. The MrBBS CDS is fused to a C-termial StrepII-tag.DepositorInsertMrBBS:StrepII
UseSynthetic BiologyTagsStrepIIExpressionBacterialMutationinserted gene is codon optimized for Synechocyst…PromoterPpetE:BCD2Available SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-muGFP-hATG2A ΔWIR
Plasmid#215507PurposeExpresses GFP tagged human ATG2A with the mutation in WIPI interacting region.DepositorInsertAutophagy related 2A (ATG2A Human)
UseRetroviralTagsmuGFPExpressionMammalianMutationP656R (natural variant with no functional relevan…Available SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-muGFP-hATG2A mLIR
Plasmid#215506PurposeExpresses GFP tagged human ATG2A with the mutation in LC3 interacting region.DepositorInsertAutophagy related 2A (ATG2A Human)
UseRetroviralTagsmuGFPExpressionMammalianMutationP656R (natural variant with no functional relevan…Available SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETM11-SUMO3- sfGFP-KSR1-CA3 (N-KSR)
Plasmid#217767PurposeFluorescent reporter for glucosyl-ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseProtein purification (6xhis tag, tev site, sumo3 …TagssfGFPExpressionBacterialMutationCA3 domain aa 317-400PromoterT7 promoterAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFS_1112_pET30_pCat-tetR-Term-ptetA-FsRT-Cas1(opt)-Cas2(opt)-3xTerm_J23109-Leader-ARRAY2-DR2-FaqI_Term_NotI
Plasmid#184740Purposeencodes aTc inducible FsRT-Cas1–Cas2 expression cassette and FsCRISPR Array 2 transcribed by BBa_J23109DepositorInsertFsRT-Cas1(opt)-Cas2(opt)
ExpressionBacterialMutationsequence codon optimized for expression in E. coliPromoterpTetAAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H150
Plasmid#170345Purpose6xHis_mT2Del_EPACdDEPCD_Q270E_cp174Cit biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsert6xHis_mT2Del_EPACdDEPCD_Q270E_cp174Cit (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H94
Plasmid#170341PurposeGFP(UST)_EPACdDEPCD_mCherry biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertGFP(UST)_EPACdDEPCD_mCherry (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only