We narrowed to 14,509 results for: SHR;
-
Plasmid#193226PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pUC19-U6-BsmBI_cassette-CjeCas9-sgRNA (KAC482)
Plasmid#133793PurposeU6 promoter sgRNA entry vector used for all CjeCas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to V2-TGAA linker sgRNA architecture from Kim et al. Nature Communications 2017DepositorInsertCjeCas9 sgRNA entry vector
ExpressionMammalianMutationV2-TGAA linker sgRNA architecture from Kim et al.…PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F2-GFP
Plasmid#91882PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cas9_YTHDF2_sgRNA
Plasmid#186673PurposeYTHDF2 sgRNA plasmidDepositorInsertYTHDF2 KO sgRNA Plasmid (YTHDF2 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
NADK2 gRNA (BRDN0001146214)
Plasmid#78091Purpose3rd generation lentiviral gRNA plasmid targeting human NADK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97310PurposeNHEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb NHEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GSG1l-GFP KI
Plasmid#131492PurposeEndogenous tagging of GSG1-l: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRIB2 gRNA (BRDN0001148332)
Plasmid#75604Purpose3rd generation lentiviral gRNA plasmid targeting human TRIB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SIK1 gRNA (BRDN0001487095)
Plasmid#77893Purpose3rd generation lentiviral gRNA plasmid targeting human SIK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SIK1 gRNA (BRDN0001146021)
Plasmid#77894Purpose3rd generation lentiviral gRNA plasmid targeting human SIK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1_sh_ex13
Plasmid#35165DepositorAvailable SinceMarch 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
RIPK2 gRNA (BRDN0001146083)
Plasmid#76910Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRP[2CRISPR]-mCherry/Hygro-hCas9-U6>{mdx left}-U6>{mdx right}
Plasmid#184381PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23DepositorInsertCas9, two gRNAs targeting dystrophin
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
SYK gRNA (BRDN0001146072)
Plasmid#76777Purpose3rd generation lentiviral gRNA plasmid targeting human SYKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001148481)
Plasmid#75499Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNcor1#2/Cre
Plasmid#173606PurposeExpresses a Ncor1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ncor1 (Ncor1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
RFK gRNA (BRDN0001146181)
Plasmid#76847Purpose3rd generation lentiviral gRNA plasmid targeting human RFKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RFK gRNA (BRDN0001162491)
Plasmid#76850Purpose3rd generation lentiviral gRNA plasmid targeting human RFKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTBK2 gRNA (BRDN0001147885)
Plasmid#77968Purpose3rd generation lentiviral gRNA plasmid targeting human TTBK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only