We narrowed to 2,326 results for: dcas9
-
Plasmid#227472Purpose12-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234370PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234372PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-24XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA033
Plasmid#216013PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas9-NG_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA035
Plasmid#216015PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas9-SpRY_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA034
Plasmid#216014PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas9-SpG_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iSAM
Plasmid#211495PurposeAAVS1 targeting vector containing an all-in-one DOX-inducible system for CRISPRaDepositorInsertsUniSAM insert
TET-ON
Neo Resistance
Insulator
UseCRISPR and Synthetic BiologyTagsT2A-mCherry TagExpressionMammalianPromoterEF1a, NA, Splicing acceptor, and TREGV promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF1a FLAG-CHMP2B
Plasmid#232012PurposeExpression of FLAG-tagged CHMP2BDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a FLAG-CHMP2B-d55-96
Plasmid#232013PurposeExpression of FLAG-tagged CHMP2B with the second alpha helix deleted.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a mNeonGreen-3K-B1-10-IRES-mKate2-2A-PuroR
Plasmid#215377PurposeLentiviral expression of a cytosolic-localized split mNeonGreen variant that enables efficient complementation when the missing beta strand is present. mKate2 is present as a transduction control.DepositorInsertmNeonGreen-3K-1-10
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRI003-pGEM-LS-Bar-PgpdA-dSpCas9-VPR-TtrpC-LS
Plasmid#140196PurposeChromosomal integration of PgpdA-dSpCas9-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi vector.DepositorInsertsdSpCas9-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta) , NLSPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLex307-UCOE-SFFV-puroR-MCP-MLLx3-HSF1
Plasmid#218558PurposeEncodes SFFV promoter-driven MCP-MLLx3-HSF1 with an N-terminal bipartite SV40 NLS, along with puromycin resistanceDepositorInsertMCP-MLLx3-HSF1
UseLentiviralTagsSV40NLSExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…Available SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLex307-UCOE-SFFV-puroR-MCP-P65-HSF1
Plasmid#218559PurposeEncodes SFFV promoter-driven MCP-P65-HSF1 with an N-terminal bipartite SV40 NLS, along with puromycin resistanceDepositorInsertMCP-P65-HSF1
UseLentiviralTagsSV40NLSExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…Available SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
synapsin-hIRβ-mCherry
Plasmid#228449PurposeExpressing a truncated, constitutively active human insulin receptor (IRβ) with mCherry in rat primary hippocampal neuronsDepositorInserthuman Insulin Receptor beta subunit (INSR Human)
UseAAVPromoterneuron-specific synapsin promoteAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTP MYRF sg1
Plasmid#88857PurposepAC154-dual-dCas9VP160-sgExpression with MYRF sg1 cloned into BbsI siteDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTP MYRF sg2
Plasmid#88858PurposepAC154-dual-dCas9VP160-sgExpression with MYRF sg2 cloned into BbsI siteDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTP MYRF sg3
Plasmid#88859PurposepAC154-dual-dCas9VP160-sgExpression with MYRF sg3 cloned into BbsI siteDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTP MYRF sg4
Plasmid#88860PurposepAC154-dual-dCas9VP160-sgExpression with MYRF sg4 cloned into BbsI siteDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTP MYRF sg5
Plasmid#88861PurposepAC154-dual-dCas9VP160-sgExpression with MYRF sg5 cloned into BbsI siteDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTP MYRF sg6
Plasmid#88862PurposepAC154-dual-dCas9VP160-sgExpression with MYRF sg6 cloned into BbsI siteDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2T-CMV-ABE8e_dNRCH-BlastR
Plasmid#232720PurposeA-to-G base editorDepositorInsertABE8e-dCas9(NRCH)
ExpressionMammalianMutationwithin Cas9 D10A H840AAvailable SinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-NC-CRISPRi (Gen3)
Plasmid#73499PurposeConstitutive CRISPR interference (CRISPRi) knock in construct into the AAVS1 locusDepositorInsertdCas9-KRAB
UseCRISPRTagsHA, KRAB, and NLSExpressionMammalianMutationD10A, H840A (catalytically deactivated Cas9)PromoterCAGAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
DOX_SAM_CRISPR-activation-2A-GFP-AAVS1-targeting-construct
Plasmid#176836PurposeTargeting construct for intergrating a doxycycline (DOX) inducible SAM CRISPR activation complex -2A-GFP to the AAVS1 locus.DepositorInsertdCas9-VP64-2A-MS2-p65-HSF1-2A-GFP
UseUnspecifiedMutationSee Depositor Comments BelowPromoterTet operator (tetracycline inducible expression)Available SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO5-SgHottip-GFP-CRISPRa
Plasmid#134990PurposedCas9-mediated activation of HOTTIP in mammalian cellsDepositorAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NLS-DNMT3A-L-N-spC9-N-intein-hGH
Plasmid#112212PurposeTargeted DNA methylationDepositorAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLex307-UCOE-SFFV-puroR-MCP-HSF1-VIRF2
Plasmid#218557PurposeEncodes SFFV promoter-driven MCP-HSF1-VIRF2 with an N-terminal bipartite SV40 NLS, along with puromycin resistanceDepositorInsertMCP-HSF1-VIRF2
UseLentiviralTagsSV40NLSExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…Available SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d sgCiPELO #1
Plasmid#228932PurposeExpression of dCas9-KRAB and sgRNA targeting PELODepositorInsertPELO gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d sgCiPELO #8
Plasmid#228934PurposeExpression of dCas9-KRAB and sgRNA targeting PELODepositorInsertPELO gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO5-SgHottip-GFP-CRISPRi
Plasmid#134989PurposedCas9-mediated inactivation of HOTTIP in mammalian cellsDepositorAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDD143
Plasmid#119880PurposeArabinose inducible dCas9sth1 and constitutive sgRNA on pAL5000/pMB1 backbone with gentamicin resistance.DepositorInsertpBAD_dCas9sth1
ExpressionBacterialAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
GWF180
Plasmid#133607PurposeCAG-DNCR2-VPR-IRES-Puro-WPRE-SV40PA-PGK-NS3aH1-tagBFP-SpdCas9DepositorInsertDNCR2-VPR, NS3aH1-tagBFP-SpdCas9
ExpressionMammalianAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-Cas9-FCPF
Plasmid#220132PurposeExpresses Cas9-FCPF in E.coliDepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAH18
Plasmid#154397PurposeDerived from pGPI-SceI; Trimethoprim resistant; carries I-SceI gene; contains 475 bp from both upstream and downstream flanking regions between the FRT sites on pAHCTX1-rhadCas9DepositorInsertFused upstream and downstream homologous regions around FRT sites when pAH-CTX1-rhadCas9 integrated into K56-2 genome
UseSynthetic BiologyExpressionBacterialPromoterNAAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
JPF0535a
Plasmid#124042PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing spdCas9 fused to tagBFP P2A tagBFP, and an sgRNA targeting pTRE expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-spdCAS9::tagBFP-P2A-tagBFP-SV40PA_mu6-sgTRE_pTRE-NLS::mAzamiGreen-rgPA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB365
Plasmid#124048PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to mRuby2 P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::mRuby2-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB366
Plasmid#124049PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to KRAB domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::KRAB-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB367
Plasmid#124050PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to VPR domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::VPR-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-NDi-CRISPRi (Gen1)
Plasmid#73497PurposeDox-inducible CRISPR interference (CRISPRi) knock in construct into the AAVS1 locus with mCherry markerDepositorInsertsdCas9-KRAB-P2A-mCherry
rtTA
UseCRISPRTagsHA, KRAB, and NLSExpressionMammalianMutationD10A, H840A (catalytically deactivated Cas9)PromoterCAG and TRE3GAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only