We narrowed to 13,854 results for: GAN
-
Plasmid#159682PurposeMammalian protein expression of NRAS-Halotag fusionDepositorAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-CAG-iSeroSnFR-Nlgn
Plasmid#128485PurposeFluorescent reporter for serotonin (dendrite localization tag)DepositorHas ServiceAAV9InsertiSeroSnFR
UseAAVTagsFull-length neuroligin, Ig-kappa leader, and cpsf…ExpressionMammalianPromoterCAGAvailable SinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdCD19-ST3-His_withSUMO
Plasmid#223219PurposeExpression of the extracellular domain of human CD19 fused to Spytag003 + Histag in HEK293(or similar) with SUMO for better protein expressionDepositorInsertextracellular domain of B-lymphocyte antigen CD19 (CD19 Human)
TagsHistag, SUMO, and SpytagExpressionMammalianPromoterCMVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-MHL.RBBP4
Plasmid#125173PurposeExpresses human RBBP4 in insect cells, under a TEV-cleavable N-terminal polyhistidine tag.DepositorInsertHistone-binding protein RBBP4 (RBBP4 Human)
TagsHis-TEV siteExpressionInsectPromoterPolyhedrinAvailable SinceMay 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
P932_CLYBL-CBX3-Cbh-Zeo-TetO-NEUROG2
Plasmid#202762PurposeEncodes one forebrain neuron specific transcription factor under the control of a TetOn promoter at the CLYBL safe harborDepositorAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
P521_VSX2_p2A-h2b_mRuby3
Plasmid#239104PurposeUsed in CRISPR gene editing to Insert a p2A-h2b_mRuby3 sequence before the stop codon of the endogenous human VSX2 geneDepositorInsertVSX2 (VSX2 Human)
UseCRISPRTags-p2A-h2b-mRuby3ExpressionMammalianPromoterEndogenous VSX2 promoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV_msfGFP-SEPT7 Gmut2
Plasmid#180425Purposemammalian expression of human SEPT7 Gmut2 fused to monomeric superfolder GFPDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
iGFP-beta-actin
Plasmid#231553PurposeMammalian expression of human beta actin fused intramolecularly to monomeric superfolder GFPDepositorAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAB1923 REPAIR.t1-S
Plasmid#176321PurposeCMV-HIVNES-GS-dCas13bt1- (GGS)2- huADAR2dd(E488Q/E620G/Q696L) (REPAIR.t1-S expression, specificity enhancing mutations)DepositorInsertsUseCRISPRTagsHIV NESExpressionMammalianMutationE488Q/E620G/Q696L, only the deaminase domain (aa …PromoterCMVAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-PE2-IRES-ZeoR
Plasmid#207352PurposeLentiviral transfer plasmid containing CMV-driven expression cassette encoding PE2 enzyme for prime editing.DepositorInsertPrime editor 2 (PE2) enzyme
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRIP12-V2_A755-A841
Plasmid#194759PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceJuly 19, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCS2plus-TDP-43 M337V
Plasmid#162609PurposeAllows for transcription of mutant TDP-43-M337V mRNA for injection into zebrafish embryos for BiFC assaysDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMIH-mRuby2-BAK
Plasmid#111627PurposeFluorescent fusion protein used to visualise mouse BAK, with hygromycin selectionDepositorAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLED.NPL
Plasmid#193014PurposeNeuron-specific reporter (CBh promoter, Pls3 exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#1
Plasmid#174152PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgPnpt1-1#
Plasmid#234769Purposeknockout Pnpt1DepositorInsertPnpt1 (Pnpt1 )
UseLentiviralAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
miniTol2 x EF1a_EKAREN5 + PGK-puro
Plasmid#167817PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
Tagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV TRE3G Neo GFP-Progerin C661S
Plasmid#118711PurposeLentiviral TET-ON inducible GFP-Progerin C661S (Farnesylation mutant)DepositorInsertGFP-Progerin C661S (LMNA Human)
UseLentiviral; Tet-on inducibleTagsGFPExpressionMammalianMutationC661S farnesylation mutantPromoterCMV TRE3G (TET-ON)Available SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-Lbr-V5-mCherry
Plasmid#235094PurposeLbr mCherry fusion protein without MCP domainDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only