We narrowed to 83,722 results for: ell
-
Plasmid#123329PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity. Contains monomeric Venus/cpVenus-E172 homoFRET pair.DepositorInsertVenus-cpVenus-FLARE-AKAR
Tags6xHIS, T7 tag (gene 10 leader), Venus, Xpress (TM…ExpressionMammalianPromoterCMVAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
ESAM-bio-His
Plasmid#51751PurposeExpresses full-length Endothelial cell-selective adhesion molecule precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertESAM (ESAM Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-RCAN2
Plasmid#116786PurposeLentiviral expression of RCAN2DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
CMV-FLAG-TAOK2
Plasmid#197862PurposeExpression of FLAG-tagged TAOK2 / PSK1 alpha in mammalian cellsDepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-3xFLAG-LMNB1
Plasmid#207777PurposeDonor template for Blast-2A-3xFLAG insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xFLAG Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pD649-HAsp-ROBO4-Fc(DAPA)-AviTag-6xHis
Plasmid#156864PurposeMammalian expression of secreted protein fused to Fc(DAPA)-Avi-6xHis.DepositorInsertROBO4 (ROBO4 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA4TO K164A H165A CoV-2 nsp1 3xFLAG
Plasmid#176060PurposeExpresses K164A K165A CoV2 nsp1 in mammalian cells. This contains a C-terminal 3xFLAG tag fusion to nsp1.DepositorInsertCoV-2 K164A H165A nsp1 (ORF1ab SARS-CoV-2)
Tags3xFLAGExpressionMammalianMutationK164A and H165APromoterCMVAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMT2-HA-RAPGEF2(S1244A/S1248A)
Plasmid#110163PurposeExpression of human RAPGEF2 (S1244A/S1248A) in mammalian cellsDepositorInsertRAPGEF2 (Rap guanine nucleotide exchange factor 2 (RAPGEF2 Human)
TagsHAExpressionMammalianMutationS1244A/S1248APromoterCMVAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-STK33
Plasmid#116797PurposeLentiviral expression of STK33DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-CLTC
Plasmid#227314PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold-2A-Puro Cassette (CLTC Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-PEX3
Plasmid#227304PurposeDonor template for mStayGold insertion into the C-terminus of the PEX3 locus. For peroxisome visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PEX3 (Addgene #227303)DepositorInsertPEX3 Homology Arms flanking a mStayGold Tag (PEX3 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-OTUD5 (OTU, aa 171-358)
Plasmid#61415PurposeExpresses human OTUD5 (OTU domain) in E. coli.DepositorInsertOTUD5 (OTUD5 Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-170 and aa 359-571.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-STK19
Plasmid#116795PurposeLentiviral expression of STK19DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-MAVS(pLxIS)
Plasmid#221256PurposeExpression of MAVS pLxIS (393-441) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-extGluc-NGFR
Plasmid#104832PurposeextGluc luciferase for invivo Imaging, NGFR for flourescent detection or separationDepositorInsertsextGLuc
NGFR
UseLentiviral and LuciferaseExpressionMammalianAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA4TO R124A K125A CoV-2 nsp1 3xFLAG
Plasmid#176059PurposeExpressing R124A K125A CoV2 nsp1 in mammalian cells. This contains a C-terminal 3xFLAG tag fusion to nsp1.DepositorInsertCoV-2 nsp1 R124A/K125A (ORF1ab SARS-CoV-2)
Tags3xFLAGExpressionMammalianMutationR124A and K125APromoterCMVAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-LILRA3-COMP5AP-AviTag-9xHis
Plasmid#157410PurposeMammalian expression of secreted protein fused to COMP5AP-AviTag-9xHis.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-TASL-NEMO
Plasmid#221267PurposeExpression of TASL-NEMO IKK binding site in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-TASL-PLPLR
Plasmid#221266PurposeExpression of TASL-STING PLPLR in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only