We narrowed to 13,184 results for: BASE
-
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNUT2
Plasmid#175745PurposeSingle-component photo-inducible (LOV2-based) nucleolus-targeting tool 2DepositorInsertmCherry-LOV2-NoLS (human nuclear factor-κB inducing kinase)
TagsmCherryExpressionMammalianAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRB30-GFP
Plasmid#165481PurposepTriEx based vector for protein expression in mammalian cells for targets fused with C-terminal uv-GFP, Flag and HisDepositorTypeEmpty backboneTagsTEV-GFP-FLAG-10x HisExpressionMammalianAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFH84
Plasmid#128195PurposeLevel1 ZmUBIp::A3A-PBE (wheat codon optimized):NOStDepositorInsertZmUBIp::A3A-PBE (wheat codon optimized):NOSt
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH70
Plasmid#128190PurposeLevel1 ZmUBIp::nSpCas9-PmCDA (Arabidopsis codon optimized):NOStDepositorInsertZmUBIp::nSpCas9-PmCDA (Arabidopsis codon optimized):NOSt
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHES945
Plasmid#112643Purposeblue light inducible cryptochrome based optogenetic expression systemDepositorInsertCRY2PHR-GAL4DBD
ExpressionYeastPromoterTDH3Available SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHES 946
Plasmid#112644Purposeblue light inducible cryptochrome based optogenetic expression systemDepositorInsertRTG3AD-GSx7-CIB1-SV40NLS (CIB1 Budding Yeast, Synthetic, Mustard Weed)
ExpressionYeastPromoterADH1Available SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pScaf-5544.3
Plasmid#111523PurposepScaf phagemid with insert for generating DNA origami scaffold 5544 bases in length (v3)DepositorInsertpScaf-H'I
ExpressionBacterialAvailable SinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pScaf-5544.2
Plasmid#111522PurposepScaf phagemid with insert for generating DNA origami scaffold 5544 bases in length (v2)DepositorInsertpScaf-H'C
ExpressionBacterialAvailable SinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
exon K-renilla
Plasmid#81007Purposeluciferase based mini-gene to report splicing at exon 25 in Drosophila paraylticDepositorInsertparalytic (para Fly)
TagsRenilla luciferaseExpressionInsectMutationspanning exon 24 to exon 26, termination codon in…PromoterP-AC5 (Actin 5C)Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Col1A2:TFPnls-T2a-mErt-Cre-Ert
Plasmid#111151PurposeFibroblasts specific inducible CreDepositorInsertTFPnls-T2a-mErt-Cre-Ert
UseCre/LoxMutationwtPromoterCol1A2Available SinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCA24N-ligase-cTF
Plasmid#87743PurposeIPTG-inducible expression of ligase-cTF fusion for protein purificationDepositorInsertT4 DNA ligase (30 )
Tags6xHis and cTF (chimeric transcription factor base…ExpressionBacterialPromoterT5-lacAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
MSCV P2Gm +SwaI
Plasmid#22699DepositorInsertmiR30
UseRNAi and RetroviralExpressionMammalianAvailable SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO V5 DNAJA3
Plasmid#19520DepositorInsertDnaJ (Hsp40) homolog, subfamily A, member 3 (DNAJA3 Human)
TagsV5ExpressionMammalianMutationF193L based on NP_005138.3Available SinceOct. 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-IRESMuro
Plasmid#82336PurposeBase vector targeting genes to the GAPDH locus of human cells. Inserted genes are expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertIRESMuro
UseSynthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJL355
Plasmid#243710PurposeA piggyBac vector containing the endogenous COX7A2 genomic locus, with its native 3' UTR replaced by the Actb 3' UTR, modified with silent mutations to allow for PCR-based analysisDepositorInsertCOX7A2 genomic locus, with its 3' UTR replaced by the ACTB 3' UTR (COX7A2 Human)
ExpressionMammalianAvailable SinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only