We narrowed to 8,244 results for: 11
-
Plasmid#84639PurposemCherry-tagged, wild-type LKB1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmCherry-LBK1 (STK11 Human, Synthetic)
Tags6xHis, T7 tag (gene 10 leader), Xpress (TM) tag, …ExpressionMammalianPromoterCMVAvailable sinceMay 12, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_ORI_neg.cont
Plasmid#99315PurposeNegative control for luciferase validation vectorsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertneutral region; chr3: 55198740-55200041
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLH-sgRNA-Sirius-4X(MS2-PP7)
Plasmid#121941PurposeCRISPR-Sirius plasmidDepositorInsertsgRNA-Sirius-4X(MS2-PP7)
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterhuman U6 promoterAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCFJ910
Plasmid#44481DepositorInsertMinimal Mos1, NeoR, MCS
UseMultiple cloning site vectorAvailable sinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CIB81-pmGFP
Plasmid#75366PurposeExpresses aa1-81 of Arabidopsis CIB1 fused to EGFP with CaaX membrane tag on endDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCIB1 (CIB1 Mustard Weed)
Tagsprenylated EGFPExpressionMammalianMutationresidues 1-81 of CIB1PromoterCMVAvailable sinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBI-MCS-EYFP
Plasmid#58855PurposeThe tet-responsive reporter pBI-MCS-EGFP (Addgene plasmid 16542) was modified to express YFP instead of GFPDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertenhanced yellow fluorescent protein
ExpressionMammalianPromoterCMVAvailable sinceOct. 27, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV.CMVenh.gp91.eGFP.cHS4
Plasmid#30471DepositorInsertCMVenh/gp91/eGFP/cHS4
UseLentiviralAvailable sinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pQHA-USP7 WT puroR
Plasmid#46753PurposeRetroviral vector that expresses wild type HA-tagged human USP7DepositorAvailable sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EasyFusion T2A-H2B-TagBFP
Plasmid#113086PurposeGeneral donor vector with T2A-H2B-TagBFP coding sequence flanking by restriction sites for generating knock-in donorDepositorInsertT2A-H2B-TagBFP
UseSynthetic BiologyAvailable sinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5-hGRK4
Plasmid#32690DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGRK4 (GRK4 Human)
ExpressionMammalianAvailable sinceFeb. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IZ-ANXA1-mRuby3
Plasmid#184888PurposeStable expression of ANXA1-mRuby3 (Annexin A1-mRuby3) in mammalian cellsDepositorAvailable sinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
EasyFusion mAID-mCherry with Neo
Plasmid#113831PurposeEasyFusion vector for targeting endogeneous genes with mAID-mCherryDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmAID-mCherry
UseSynthetic BiologyAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cx43-msfGFP
Plasmid#69007PurposeExpresses rat Cx43 (Gja1 CDS) with a 7 amino acid linker on the C-terminus of the Connexin linking to monomerized superfolder Green Fluorescent Protein. Expression driven by CMV promoter.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGja1 (Gja1 Rat)
Tagsmonomerized superfolder GFPExpressionMammalianPromotercmvAvailable sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMSP1E1D1
Plasmid#161605PurposeBacterial expression of "extended" membrane scaffold protein (MSP1E1D1) for Nanodisc formationDepositorInsertMSP1E1D1
Tags7-HisExpressionBacterialMutation"extended" MSP1D1; contains repeat of h…PromoterT7Available sinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SNAP-CRY2-VHH(GFP)
Plasmid#58370PurposeFor use in light-induced inactivation of GFP fused protein through the interaction with CIB1-MPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCRY2[1-498] (CRY2 Mustard Weed)
TagsSNAP and vhhGFP4ExpressionMammalianPromoterCMVAvailable sinceSept. 30, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET-MCN-10His-mStayGold (E138D)
Plasmid#211361PurposeBacterial expression of the bright and photostable monomeric StayGold fluorescent protein (E138D). Codon optimised for expression in Escherichia coli. Contains a N-terminal 10xHis tag.DepositorInsertmStayGold
Tags10xHis-tagExpressionBacterialMutationE138DPromoterT7Available sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJFRC201-10XUAS-FRT>STOP>FRT-myr::smGFP-HA
Plasmid#63166PurposeGAL4-responsive UAS "flp-On" spaghetti monster GFP-HA reporterDepositorInsert"spaghetti monster GFP-HA"
TagsN-myristoylationExpressionInsectAvailable sinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCI-HA-mAVO3 (pRL62-3)
Plasmid#39210DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmAVO3 (Rictor Mouse)
TagsHAExpressionMammalianMutationG5S and I15VPromoterCMVAvailable sinceSept. 4, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pES4/4a
Plasmid#69590PurposeTCR a chain cDNA in pES4 transgenic construct for creating OT-II miceDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTCR alpha (Tcra Mouse)
ExpressionMammalianPromoterH-2KbAvailable sinceSept. 24, 2015AvailabilityAcademic Institutions and Nonprofits only