We narrowed to 4,483 results for: Gaa
-
Plasmid#201615PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPGAM1 (PGAM1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-DNMT3a ts3
Plasmid#115867PurposeDNMT3a knockdownDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-mCherry-SPASTIN, F124D
Plasmid#180648PurposeLentiviral expression vector for SPASTIN. Has F124D mutation. Used for generating cell lines. Has N-terminal mCherry tag. Dox-inducible. SPASTIN starts on M87. Internal ID: WISP20-44.DepositorInsertSPASTIN
UseLentiviralTagsmCherryExpressionMammalianMutationStarts at M87, F124D mutation, has siRNA resistan…Available SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCCL-PGK-SPdCas9-BFP-EGFP
Plasmid#66821PurposedCas9 fused to BFP and EGFPDepositorInsertdSpCas9-BFP-EGFP
TagsdSpCas9-BFP-EGFPExpressionMammalianAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
49535-sgFMR1_E3B
Plasmid#157783PurposeExpresses a sgRNA targeting the 3rd exon of human FMR1 geneDepositorAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSC2
Plasmid#91180PurposeT-DNA vector for combinatorial deletion of NCR genes in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting NCR genes
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
PRPF4B gRNA (BRDN0001146164)
Plasmid#76428Purpose3rd generation lentiviral gRNA plasmid targeting human PRPF4BDepositorInsertPRPF4B
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
49535-sgFMR1_E17A
Plasmid#157782PurposeExpresses a sgRNA targeting stop codon of human FMR1 geneDepositorAvailable SinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
TNIK gRNA (BRDN0001149026)
Plasmid#75851Purpose3rd generation lentiviral gRNA plasmid targeting human TNIKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ADCK3 gRNA (BRDN0001148864)
Plasmid#77322Purpose3rd generation lentiviral gRNA plasmid targeting human ADCK3DepositorInsertADCK3
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK33 gRNA (BRDN0001149120)
Plasmid#76986Purpose3rd generation lentiviral gRNA plasmid targeting human STK33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ICK gRNA (BRDN0001146785)
Plasmid#77412Purpose3rd generation lentiviral gRNA plasmid targeting human ICKDepositorInsertICK
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Rabep1 shRNA 369958-CMV-delta5_2 Rabep1
Plasmid#254778PurposeRabep1 shRNA 369958 with expression of Rabep1 trucation lacking rab5 binding domain in pLKO backboneDepositorInsertshRNA 369958 and truncated Rabep1 (RABEP1 Human)
UseLentiviralMutation5/2 deletionPromoterCMVAvailable SinceMay 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAvA143
Plasmid#248147Purposemutated LuxR transcriptional activator for expression in yeast: fused with Gal4 activation domain with 'gen2' mutationsDepositorInsertluxR (gen3 mutations)
UseIntegration vectorTagsGal4 activation domain and nuclear localization s…ExpressionYeastMutationGal4_AD: F51 (TTC→TTT), G88E. LuxR: K53E, N86Y, I…PromoterpPGK1Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAvA141
Plasmid#248146Purposemutated LuxR transcriptional activator for expression in yeast: fused with Gal4 activation domain with 'gen2' mutationsDepositorInsertluxR (gen2 mutations)
UseIntegration vectorTagsGal4 activation domain and nuclear localization s…ExpressionYeastMutationGal4_AD: G8V. NLS: K120N. LuxR: N86K, K104E, M135VPromoterpPGK1Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-1
Plasmid#177781PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only