We narrowed to 1,111 results for: SAM-2
-
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5-LRRK2
Plasmid#229019PurposeExpression of untagged full length human LRRK2 in mammalian cellsDepositorInsertLeucine-rich repeat kinase 2 (LRRK2 Human)
Tagsno tags (untagged)ExpressionMammalianMutationnonePromoterCMVAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLEX307 hDVL1
Plasmid#102863PurposeExpresses human DVL1 in mammalian cellsDepositorInserthuman Dishevelled 1 (DVL1) (DVL1 Human)
UseLentiviralExpressionMammalianMutationChanged alanine 2 to glycine. Likely due to poly…PromoterEF1AAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsynapsin-DIO-adra2a-shRNA-mCherry
Plasmid#245063PurposeAAV-transgene knocking down adra2a receptor (adrenergic 2a receptor) transcripts cell type-selectively. Using the pPRIME. system, this generates mir30-derived shRNAs and a marker from the same RNA.DepositorInsertAAV-human synapsin promoter-DIO-adra2a-shRNA-mCherry (Adra2a Mouse, Synthetic)
UseAAV, Cre/Lox, and RNAiPromoterhuman synapsinAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB513B-1/TRE-hHNF1β-hHNF4α-hHNF6-EF1α-Bla
Plasmid#199551PurposePiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1β-hHNF4α-hHNF6) under control of the TRE/PCMVmin promoterDepositorUsePiggybac transposon vectorExpressionMammalianPromoterTRE+CMVmin promoterAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FGFR1
Plasmid#116740PurposeLentiviral expression of FGFR1DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 3xFlag
Plasmid#110063PurposeFGFR2 expression in mammalian cells (JCOPCO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationnonePromoterCMVAvailable SinceDec. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 F276C 3xFlag
Plasmid#110064PurposeFGFR2 F276C expression in mammalian cells (JCOPO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Phenylalanine 276 to Cysteine (F276C)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 K41E 3xFlag
Plasmid#110105Purposeexpresses FGFR2 with a single amino acid change in mammalian cellsDepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Lysine 41 to Glutamic acid (K41E)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only