We narrowed to 1,694 results for: CAG promoter
-
Plasmid#115464PurposeConstitutive lentiviral expressionDepositorAvailable SinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits only
-
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-Nono-sh1
Plasmid#127650PurposeKnock-down of human NONODepositorInsertNONO shRNA (NONO Human)
UseLentiviralAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
shERK2a-mlpx-puro
Plasmid#65229Purposeencodes a shRNA against ERK2DepositorInsertshRNA against ERK2 (MAPK1 Human)
ExpressionMammalianAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
px330 p300 gRNA
Plasmid#165591PurposeInsertion of p300 degronDepositorAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
lentiCRISPR - DDX3Y sgRNA 1
Plasmid#70656PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against DDX3Y
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX198
Plasmid#89262PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01DepositorInsertOsPDS-gRNA01
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 1
Plasmid#70655PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 2
Plasmid#70654PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX203
Plasmid#89267PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsDEP1 gene, OsDEP1-gRNA02DepositorInsertOsDEP1-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
sUPRa
Plasmid#223242PurposesUPRa is a dual promoter and two-color construct, which is designed to report the global unfolded protein response (UPR) and affords unbiased cell detection irrespective of UPR levelsDepositorInsertsUPRa
UseAAVPromoterCustomAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBT267_(pCA-ATG-intron-tTA2-TRE-tdT3Myc)
Plasmid#36879DepositorInsertstTA2
tdT-3Myc
Tags3 Myc tagsExpressionMammalianMutationinsertion of a beta-globin intron with a loxP sit…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
JPF0446
Plasmid#124022PurposeBxBI Destination vector with H2B::GFP expressed from CAG promoterDepositorInsertBXBI_pCAG-H2B::msfGFP-bghpA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPD766 TRE3GV DsRE2 in TUPV1
Plasmid#253881PurposeComponents for Integration Vectors: mMoClo TUPV, with TRE3GV promoter and DsRe2 in the MCSDepositorInsertDsRE2
UseSynthetic BiologyExpressionMammalianPromoterTRE3GVAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD769 TRE3GV HIF1a in TUPV2
Plasmid#253882PurposeComponents for Integration Vectors: mMoClo TUPV, with TRE3GV promoter and HIF1a* in the MCSDepositorInsertHIF1a*
UseSynthetic BiologyExpressionMammalianPromoterTRE3GVAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1043 TRE3GV mTagBFP2
Plasmid#253903PurposeComponents for Integration Vectors: mMoClo TUPV, with TRE3GV promoter and mTagBFP2 in the MCSDepositorInsertmTagBFP2
UseSynthetic BiologyExpressionMammalianPromoterTRE3GVAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1354 TRE3GV LumiScarlet in TU1
Plasmid#253905PurposeComponents for Integration Vectors: mMoClo TUPV, with TRE3GV promoter and LumiScarlet in the MCSDepositorInsertLumiScarlet
UseSynthetic BiologyTags3xFLAGExpressionMammalianPromoterTre3GVAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgAAVS1-HepmTurquoise2
Plasmid#192828PurposeExpresses sgRNA targeting AAVS1 (non-targeting control sgRNA for mouse) and mTurquoise2 from hepatocyte-specific promoterDepositorInsertmTurquoise2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 for sgRNA and hepatocyte-specific promoter (HS…Available SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMCS-rybozyme-IRES-CAS9
Plasmid#64668PurposePlasmid encoding multiple cloning site, rybozyme and IRES-CAS9.DepositorInsertsCAS9
HDV ribozyme
UseCRISPRTagsFlag, Internal ribosome entry site, and guide RNA…ExpressionMammalianAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only