We narrowed to 15,985 results for: grna
-
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only
-
LL - hOCT4i -1
Plasmid#12198DepositorAvailable SinceSept. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shLuc
Plasmid#136587PurposeExpresses an inducible short hairpin targeting firefly luciferase sequenceDepositorInsertshLuc
UseLentiviralExpressionMammalianAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPU-huTRIMmiR30-TRIM5
Plasmid#132938PurposeAll-in-one huTRIM5 rescue-TRIM5 shRNA knockdownDepositorInserthuman TRIM5
UseLentiviral and RNAiExpressionMammalianPromoterSFFVAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ143-ZmUbi-tRNA
Plasmid#158400PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ133-tRNA2.0; assembly of 3 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGCP123-GFP_g1
Plasmid#153518PurposesgRNA to GFP gene (NT) under nisin-inducible nisA promoter, barcodedDepositorInsertPnisA-sgRNA(GFP_g1)_dCas9 scaffold (barcoded)
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133-tRNA2.0
Plasmid#158395PurposeGolden Gate entry vector to express the 3rd gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-tRNA2.0
Plasmid#158396PurposeGolden Gate entry vector to express the 4th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pREDIT_Cas9n-MS2-BB_BbsI
Plasmid#164804PurposeREDIT backbone for nickase Cas9n, pU6-MS2-gRNA-backbone(BbsI)-CBH-SpCas9n(D10A)-T2A-EGFPDepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shSmad4
Plasmid#37046DepositorAvailable SinceJan. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRS-puro shNEDD4L #1
Plasmid#27016DepositorAvailable SinceDec. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pYPQ135B2.0
Plasmid#167159PurposeGolden Gate entry vector to express the 5th gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC2
Plasmid#183298PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC2 geneDepositorInsertHDAC2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ144-ZmUbi-tRNA
Plasmid#158402PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ134-tRNA2.0; assembly of 4 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.ATMi
Plasmid#14581DepositorAvailable SinceMarch 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
pYPQ146-ZmUbi-tRNA
Plasmid#158404PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ136-tRNA2.0; assembly of 6 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
D. vulgaris sp2 CRISPR/pACYCDuet-1
Plasmid#81186PurposeExpresses CRISPR array containing 3 copies of Desulfovibrio vulgaris spacer 2 and flanking repeats in E. coliDepositorInsertSynthetic CRISPR array (3 copies of D. vulgaris spacer #2 flanked by repeats)
UseCRISPRTagsNoneExpressionBacterialPromoterT7Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQ135-tRNA2.0
Plasmid#158397PurposeGolden Gate entry vector to express the 5th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ136B2.0
Plasmid#167160PurposeGolden Gate entry vector to express the 6th gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only