We narrowed to 16,154 results for: grna
-
Plasmid#14091DepositorAvailable SinceFeb. 23, 2007AvailabilityAcademic Institutions and Nonprofits only
-
pLCRISPR-CMV
Plasmid#102609PurposeControl lentivector expressing Cas9 and gRNA scaffoldDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJan. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
SiC-V1
Plasmid#133041PurposeSiC-V1 vector with SpCas9 gene and dTomato reporter. sgRNA targeting a gene of interest can be cloned downstream of U6 promoter.DepositorInsertSpCas9
UseCRISPR and LentiviralTagsdTomatoAvailable SinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd (no NLS) g4+g10+g18 (FWA)
Plasmid#117168PurposeCRISPR Cas9 SunTag system to target NtDRMcd (without an NLS) to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_NLS_GB1_noNLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TOP1
Plasmid#183323PurposeAll-in-One CRISPRko system with a guide RNA that targets TOP1 geneDepositorInsertTOP1
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_AAVS1A
Plasmid#183337PurposeAll-in-One CRISPRko system with a guide RNA that targets the AAVS1 locusDepositorInsertAAVS1A
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LL - hOCT4i -1
Plasmid#12198DepositorAvailable SinceSept. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLentiX2-PURO-shLKB1-Ms
Plasmid#61231PurposeLentivirus expressing shRNA to mouse LKB1DepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMTKM05
Plasmid#233477PurposeSpCAS9-Tyr-[gRNA: BsaI GFP dropout] with pan(OPT)ARS replication origin and Hyg selection.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_AAVS1B
Plasmid#183338PurposeAll-in-One CRISPRko system with a guide RNA that targets the AAVS1 locusDepositorInsertAAVS1B
UseLentiviralAvailable SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ143-ZmUbi-tRNA
Plasmid#158400PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ133-tRNA2.0; assembly of 3 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shLuc
Plasmid#136587PurposeExpresses an inducible short hairpin targeting firefly luciferase sequenceDepositorInsertshLuc
UseLentiviralExpressionMammalianAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT40
Plasmid#223412PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for monocot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpRY-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TOP2B
Plasmid#183325PurposeAll-in-One CRISPRko system with a guide RNA that targets TOP2B geneDepositorInsertTOP2B
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TOP2A
Plasmid#183324PurposeAll-in-One CRISPRko system with a guide RNA that targets TOP2A geneDepositorInsertTOP2A
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p{CFD4-EYFP-3xP3::DsRed}
Plasmid#86863PurposeExpresses an EYFP gRNA ubiquitously and DsRed in eyes as a marker. With attB integration site.DepositorTypeEmpty backboneExpressionInsectAvailable SinceFeb. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-tetO-CTR1-shRNA
Plasmid#53180PurposeExpresses shRNA against human CTR1 from puromycin resistance retroviral vectorDepositorAvailable SinceSept. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FGFR3
Plasmid#183291PurposeAll-in-One CRISPRko system with a guide RNA that targets FGFR3 geneDepositorInsertFGFR3
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pREDIT_Cas9n-MS2-BB_BbsI
Plasmid#164804PurposeREDIT backbone for nickase Cas9n, pU6-MS2-gRNA-backbone(BbsI)-CBH-SpCas9n(D10A)-T2A-EGFPDepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only