We narrowed to 15,910 results for: grna
-
-
LentiCRISPR-V2_hMSH2
Plasmid#186155PurposesgRNA targeting human MSH2 geneDepositorAvailable sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shCTRL
Plasmid#181875PurposeExpresses a control shRNA with no known targets in the mouse genome under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertcontrol shRNA with no known targets in the mouse genome
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-CAG-LSL-mCherry-shPtbp1
Plasmid#178591PurposeCre-dependent expression of mCherry and a shRNA against Ptbp1 under the constitutive promoterDepositorInsertmiRE-Ptbp1
UseAAVExpressionMammalianAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-tdTomato-miRE_shRen-Puro
Plasmid#135687PurposeConstitutive expression (CMV promoter) of tdTomato cDNA plus miRE-embedded shRenilla (control shRNA), Puromycin selectionDepositorInsertshRenilla
UseLentiviralAvailable sinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
px330 EZH2 - pDY052
Plasmid#171107PurposeExpresses Cas9 and an sgRNA targeting EZH2DepositorInsertCas9
ExpressionMammalianAvailable sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-LwaCas13acrRNA-BsmBIcassette (LTH151)
Plasmid#171129PurposeLwaCas13a crRNA entry vector for pU6 expression (need to clone in spacer into BsmBI sites)DepositorInsertU6 promoter entry plasmid for LwaCas13a crRNA cloning
UseCRISPRExpressionMammalianPromoterU6Available sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
rAAV-U6-MeCP2shRNA-CamKIIa-mCherry
Plasmid#169704PurposeMeCP2 KnockdownDepositorInsertshRNA against MeCp2 (Mecp2 Mouse)
UseAAVAvailable sinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgNeg1
Plasmid#166998PurposeLentiviral expression of negative control sgRNA for CRISPRi knockdownDepositorInsertNegative control sgRNA 1
UseCRISPR and LentiviralPromoterU6Available sinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGLS_2
Plasmid#163459Purposelentiviral vector expressing Cas9 and an sgRNA targeting GLSDepositorAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGLS_6
Plasmid#163460Purposelentiviral vector expressing Cas9 and an sgRNA targeting GLSDepositorAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEXfrt-SaCas9-U6-sgRosa26
Plasmid#159915PurposeMutagenesis of Rosa26DepositorInsertRosa26 (Gt(ROSA)26Sor Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgHtr2a
Plasmid#159908PurposeMutagenesis of Htr2aDepositorInsertHtr2a (Htr2a Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgSlc6a3
Plasmid#159902PurposeMutagenesis of Slc6a3DepositorInsertSlc6a3 (Slc6a3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAS9cd
Plasmid#141252PurposeConstitutive expression of Cas9 for addressing two targets; Contains two guide RNA expression cassette with stuffer and KpnI-Pme1 restriction sites.DepositorTypeEmpty backboneUseCRISPRExpressionYeastPromoterTEF1 (Cas9), pSNR52 (gRNA)Available sinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable sinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgNT
Plasmid#138678PurposeExpresses a Non-targeting sgRNA and Cas9DepositorInsertsgNT
UseLentiviralPromoterhU6Available sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMyc_2
Plasmid#138346PurposeExpress guide RNA 1 for mouse MycDepositorAvailable sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
BII-Sh-BnTW
Plasmid#133365PurposePiggybac vector for shRNA-mediated knockdown, with co-expression with tdTomato-NLSDepositorInserttdTomato-NLS
TagsFlag-tagged tdTomatoExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available sinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -