We narrowed to 16,393 results for: grna
-
Plasmid#99888PurposeGolden Gate entry vector to express the 2nd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only
-
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131B2.0
Plasmid#99885PurposeGolden Gate entry vector to express the 1st gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC1
Plasmid#183297PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC1 geneDepositorInsertHDAC1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15516_BEAR-GFP-2in1
Plasmid#174082PurposeBEAR-GFP plasmid with a gRNA that targets its own plasmidDepositorInsertEGFP split with an intron between amino acids 95-96
UseCRISPRExpressionMammalianMutationdisrupted 5' splice sitePromoterCMVAvailable SinceDec. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast-SCRAMBLE
Plasmid#26701Purpose3rd gen lentiviral shRNA expression vector containing scrambled shRNA sequence. Uses blasticidin for selectionDepositorInsertscramble
UseLentiviral and RNAiExpressionMammalianAvailable SinceFeb. 3, 2011AvailabilityAcademic Institutions and Nonprofits only -
px459 sgAtg5
Plasmid#175023PurposeCRISPR-Cas9 plasmid targeting exon 2 of human Atg5.DepositorInsertATG5 (ATG5 Human)
ExpressionMammalianAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGreenPuro-shRNA-Stx3S-C4
Plasmid#99742Purpose3rd generation lentiviral vector expresses shRNA against human Stx3S with a GFP reporter.DepositorInsertshRNA against Stx3S
UseLentiviral and RNAiExpressionMammalianPromoterH1Available SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT56
Plasmid#223428PurposeT-DNA vector for dSpCas9 mediated gene activation for dicot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB) (PX460)
Plasmid#48873PurposeCas9n (D10A nickase mutant) from S. pyogenesDepositorHas ServiceCloning Grade DNAInserthSpCas9n
UseCRISPRTags3XFLAGExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
BPK3079
Plasmid#78741PurposeHuman expression plasmid for AsCpf1 guide RNA (need to clone in spacer into BsmBI sites)DepositorInsertAsCpf1 crRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B2.0
Plasmid#99892PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO mouse shRNA 2 raptor
Plasmid#21340DepositorAvailable SinceJuly 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
pYPQ135B2.0
Plasmid#167159PurposeGolden Gate entry vector to express the 5th gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ136B2.0
Plasmid#167160PurposeGolden Gate entry vector to express the 6th gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl
Plasmid#70007PurposeCRISPR/Cas9 vector for Yarrowia lipolytica, with AvrII site for sgRNA insertionDepositorInsertsCodon optimized Cas9 from S. pyogenes
sgRNA expression cassette
UseCRISPR and Synthetic BiologyExpressionYeastPromoterSCR1'-tRNA and UAS1B8-TEF(136)Available SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shSMAD4 #2
Plasmid#83091PurposeLentiviral shRNA vector for inducible knockdown of human SMAD4DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIIS948-CXCR4
Plasmid#238213PurposeTasR tigRNA expression to target CXCR4 under U6 promoter in human cells.DepositorInserttigRNA
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDIV270
Plasmid#226181PurposeExpresses Cas9 and gRNA targeting KU70 gene in K. phaffii.DepositorInserttRNA-sgRNA-tRNA
UseCRISPRExpressionBacterial and YeastPromoterTEF1p (Komagataella phaffii)Available SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP shRNA tet pLKO puro
Plasmid#163017PurposeControl tet-inducible shRNA targeting eGFPDepositorInsertEnhanced Green Fluorescent Protein
UseLentiviralAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only