We narrowed to 27,807 results for: CAL
-
Plasmid#91466PurposeProtein expression and purification of human SH3 domain construct STAC3-2/2DepositorInsertSTAC3-2/2 (STAC3 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SH3GL1-1/1
Plasmid#91473PurposeProtein expression and purification of human SH3 domain construct SH3GL1-1/1DepositorInsertSH3GL1-1/1 (SH3GL1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_VAV2-1/2*
Plasmid#91483PurposeProtein expression and purification of human SH3 domain construct VAV2-1/2*DepositorInsertVAV2-1/2* (VAV2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_STAC3-1/2
Plasmid#91271PurposeProtein expression and purification of human SH3 domain construct STAC3-1/2DepositorInsertSTAC3-1/2 (STAC3 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
CYYR1_pCSdest
Plasmid#53794DepositorAvailable SinceMarch 27, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTS1026-Tier1-PhCMV-3xNLS-iRFP670
Plasmid#169532PurposeTier-1 vector encoding PhCMV-driven iRFP670 that is localized to the nucleus (PhCMV-3xNLS-iRFP670-pA).DepositorInsertPCMV-driven nucleus-localized far-red fluorescent protein iRFP670
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SPTAN1-1/1
Plasmid#91292PurposeProtein expression and purification of human SH3 domain construct SPTAN1-1/1DepositorInsertSPTAN1-1/1 (SPTAN1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
PXCGW
Plasmid#48255PurposeSplit-GFP assay in plantsDepositorTypeEmpty backboneUseBinary gateway vectorTags6xHIS and CFP aa155-238Promoter35SAvailable SinceOct. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_NR2E1_Hormone-recep
Plasmid#109851PurposeProtein expression and purification of NR2E1_Hormone-recepDepositorInsertNR2E1_Hormone-recep (NR2E1 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetD-SNAP-FOP
Plasmid#136797PurposeMammalian expression of the centrosomal protein FGFR N-terminally fused to SNAP-tagDepositorInsertSNAP-FGFR
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUHG10.3-TetO-Rs1
Plasmid#16313DepositorInserth5HT4b Serotonin Receptor (Rs1 D100A RASSL) (RS1 Human)
TagsFLAGExpressionMammalianMutationAdded FLAG tag; Changed Aspartic Acid 100 to Alan…Available SinceJan. 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
p3E-rev_U6_MCS
Plasmid#109769PurposeMultisite gateway vector for 3' expression of a guide RNA from the U6 promoter (cassette in the reverse orientation). Contains BseRI sites for insertion of gRNA sequenceDepositorInsertU6-gRNA cassette
UseZebrafish plasmidsAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGST2-CeEP55
Plasmid#21501DepositorInsertCEP55-EABR (ESCRT and ALIX Binding Region) domain (CEP55 Human)
TagsGSTExpressionBacterialMutationQ230 (CAG changed to TAA), Q218 (CAA changed to T…Available SinceFeb. 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SNX33-1/1
Plasmid#91278PurposeProtein expression and purification of human SH3 domain construct SNX33-1/1DepositorInsertSNX33-1/1 (SNX33 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL1
Plasmid#48741PurposeExpression of luciferase driven by truncated mPer2 promoter region (bases -1128 to -141 with respect to transcription start site at +1)DepositorInserttruncated mPer2 promoter/enhancer region (-1128 to -141)
UseLuciferaseMutationtruncated promoter region (see pGL6)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
minitalin (headR13DD)
Plasmid#182994Purposeexpression of minitalin wt in mammalian cellsDepositorAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL7.0: Venus-oLID-Mito (From ActA)
Plasmid#60414PurposeMammalian Expression of Venus-oLID-MitoDepositorInsertVenus-oLID-Mito
UseCre/Lox and LentiviralTagsVenusExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
Po_CyRPA-Cd4-bio-His
Plasmid#126829PurposeExpression of recombinant P. ovale protein in mammalian cellsDepositorInsertCyRPA
TagsratCd4(d3+4)-bio-6HisExpressionMammalianPromoterCMVAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only