We narrowed to 28,961 results for: tat
-
Plasmid#82896PurposeGateway Donor vector containing FCGR3B, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pMX-HA-UbvG08_MUT-IRES-GFP
Plasmid#75031PurposeRetroviral vector with ubiquitin variant with reverted mutations L69P and V70L (i53-DM mutant)DepositorInsertUbiquitin
UseRetroviralTagsHA and IRES-eGFPMutationUbvG08 with I44A, P69L, and L70V mutations and no…Available SinceJune 30, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
Desmoplakin I acceptor only control (F40-based tension sensor)
Plasmid#119189PurposeThe acceptor (mEYFP) only control for the F40-based human desmoplakin I tension sensor can be used for bleedthrough calibration or with the donor only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin I-[mTFP1(Y72G)-F40-mEYFP] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mCerulean 156-239-GGGS-TDP-43 M337V
Plasmid#162618PurposeAllows for transcription of mCerulean fluorophore half fused to mutant TDP-43-M337V for injection into zebrafish embryos for BiFC assaysDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-FLPX-rc [ChrimsonR-tdTomato]
Plasmid#128587PurposeAAV-mediated expression of ChrimsonR-tdTomato under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner. tdTomato has codons varied to reduce recombination.DepositorInsertChrimsonR-tdTomato
UseAAVTagstdTomato (codon diversified version)ExpressionMammalianMutationChrimson K176R mutantPromoterEF1α (1.1 kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
PA-DAD-dark
Plasmid#53096PurposeExpresses dark mutant PA-DAD in mammalian cells, an optogenetic tool to activate endogenous diaphanous related formins in live cells using light with LOV2 in the closed conformationDepositorInsertLOV(dark)-6aa-DAD
Tags6x His and mVenusExpressionBacterial, Insect, and Mamm…MutationL47F and C49S in Venus; C450M mutation in LOV2Available SinceAug. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PIH1D1_WT_V5
Plasmid#82943PurposeGateway Donor vector containing PIH1D1, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorInsertPIH1D1 (PIH1D1 Human)
UseGateway entry vectorMutationM9L, G10E, V224I, P287LPromoterNoneAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RNH1_WT_V5
Plasmid#82995PurposeGateway Donor vector containing RNH1, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mCerulean 156-239-GGGS-TDP-43
Plasmid#162617PurposeAllows for transcription of mCerulean fluorophore half fused to TDP-43 for injection into zebrafish embryos for BiFC assaysDepositorInsertTARDBP (TARDBP Human)
ExpressionMammalianAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag::UbvG08 P69L, L70V, I44A, deltaGG
Plasmid#74940PurposeUbiquitin variant with mutations L69P and V70L reverted to wild type (i53-DM mutant)DepositorInsertUbiquitin
TagsFlagExpressionMammalianMutationUbvG08 with I44A, P69L, and L70V mutations and no…PromoterCMVAvailable SinceMay 13, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223_EGFR_p.D837A
Plasmid#82912PurposeGateway Donor vector containing EGFR, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiMutB3GALT5catdead-blast
Plasmid#220869Purposelentiviral vector for expressing human B3GALT5 with D156A and D243A inactivating mutations and C-terminal myc-DDK tag, includes nucleotide change in PAM targeting sequenceDepositorInsertbeta-1,3-galactosyltransferase 5 (B3GALT5 Human)
UseLentiviralTagsmyc, FLAGExpressionMammalianMutationencodes D156A and D243A mutations; also, nucleoti…Available SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{ChETA-mRuby2}on-W3SL
Plasmid#111390PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection), Cre-ON ChETA-mRuby2 (for optogenetic activation), and W3SL regulatory cassette (for maximize cloning capacity)DepositorInsertsUseAAVTagsMyc and mRuby2ExpressionMammalianPromoterhSynapsinAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
p(HA)HIF1alpha(401delta603) (L795V, C800S, L818S, L822V)
Plasmid#52216Purposemammalian expression of HA tagged HIF1alpha with a deletion of the N-terminal activation domain and LCLL mutationDepositorInsertHIF1alpha (401delta603) LCLL (HIF1A Human)
TagsHAExpressionMammalianMutationaa 401-603 deleted, removes the oxygen-dependent …PromoterCMVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{ChETA-mRuby2}on-W3SL
Plasmid#111391PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON ChETA-mRuby2 (for optogenetic activation), and W3SL regulatory cassette (for maximize cloning capacity)DepositorInsertsUseAAVTagsMyc and mRuby2ExpressionMammalianPromoterhSynapsinAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
SSN-GFP
Plasmid#163663PurposeExpresses a TNF and ST6GAL1 swapped chimera with the cytosolic tail and TMD from ST6GAL1, and luminal domain from TNF in mammalian cellsDepositorInsertTagsGFPExpressionMammalianMutationThis chimera contains the cytosolic tail from ST,…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
NSN-GFP
Plasmid#163665PurposeExpresses a TNF and ST6GAL1 swapped chimera with the cytosolic tail from TNF, TMD from ST6GAL1 and luminal domain from TNF in mammalian cellsDepositorInsertTagsGFPExpressionMammalianMutationThis chimera contains the cytosolic tail from TNF…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RALA_WT_V5
Plasmid#82988PurposeGateway Donor vector containing RALA, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 KBTBD4 R313PRR
Plasmid#184626PurposeDoxycycline inducible lentiviral vector for N-terminal Flag tagged KBTBD4 R313PRR expression in mammalian cellsDepositorInsertN-terminal Flag tagged KBTBD4 R313PRR (KBTBD4 Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianMutationR313PRRPromoterTRE promoter, Tet ONAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only