We narrowed to 15,910 results for: grna
-
Plasmid#196250PurposePlasmid for cloning of a CRISPR-Cas9 guide RNA gene under promoter PJ23119DepositorInsertattL1-GlpT-scGFP-attL2
ExpressionBacterialPromoterJ23119 promoterAvailable sinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAM/CBA-eGFP-miRaSyn(human)x3-WPRE-bGHpA
Plasmid#194247PurposeExpresses 3 miRNAs targeting human alpha-SynucleinDepositorAvailable sinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX458-AAVS1-sg
Plasmid#194721Purposepx458 with guide RNA that target hAAVS1DepositorAvailable sinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pXPR_003 sgSMARCA4 guide 1
Plasmid#193604PurposeSMARCA4 knockoutDepositorInsertsgSMARCA4 guide 1 (SMARCA4 Human)
UseLentiviralAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDrop
Plasmid#184872PurposeChromosomal transfer helper plasmid with sgRNAs (one fixed, one flexible) for in-vivo excision of transferred DNA for homologous recombination and counter-selection for successful integration.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable sinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer-Opa1 KO
Plasmid#191949PurposeExpression of a siRNA that targets Opa1DepositorInsertOpa1
ExpressionMammalianAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO-Tet-On shYap1-1
Plasmid#193669PurposeTet inducible knockdown of Yap1DepositorInsertYap1 (Yap1 Mouse)
UseLentiviralAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shYAP1-1
Plasmid#193692PurposeConstitutive lentiviral expression of YAP1 shRNADepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgMaob-HepmCherry
Plasmid#192829PurposeExpresses sgRNA targeting Maob and mCherry from hepatocyte-specific promoterDepositorInsertmCherry
UseCRISPR and LentiviralExpressionMammalianPromoterU6 for sgRNA and hepatocyte-specific promoter (HS…Available sinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXD017-39 TRAC PDCD1 AAV double KO AAV
Plasmid#192153PurposeTRAC PDCD1 AAV double KO AAVDepositorInsertsgRNA
UseAAVMutationNAAvailable sinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaActin binding domain
Plasmid#187276PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Actin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaActin binding domainPromoterU6, CMVAvailable sinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPv2_AAVS1
Plasmid#184487PurposeLentivirus all in one CRISPR vector targeting human AAVS1 geneDepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralAvailable sinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgDHODH-2
Plasmid#186023Purposeknock out DHODH in mammalian cellsDepositorAvailable sinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiCRISPR v2-sgACSL4
Plasmid#186024Purposeknock out ACSL4 in mammalian cellsDepositorInsertAcyl-CoA Synthetase Long Chain Family Member 4 (ACSL4 Human)
UseCRISPR and LentiviralPromoterU6Available sinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ERBB2
Plasmid#183287PurposeAll-in-One CRISPRko system with a guide RNA that targets ERBB2 geneDepositorPublicationInsertERBB2
UseLentiviralAvailable sinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2-U3
Plasmid#173156PurposeSingle guide RNA cassette under U3 promoterDepositorInsertsgRNA cassette under U3 promoter
ExpressionPlantPromoterpromoter region of the U3C snRNA gene (Marshallsa…Available sinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
petRNA-FANCF-v3'
Plasmid#181803PurposepetRNA FANCF v3'DepositorInsertribozyme-petRNA
UseCRISPRAvailable sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-mtIF3 shRNA_TagRFP657
Plasmid#182367PurposeshRNA targeting mtIF3 mRNADepositorAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only