We narrowed to 29,920 results for: des.2
-
Plasmid#62962Purposefull length rat Endolyn cloned into delta pMEP4DepositorInsertEndolyn (Cd164 Rat)
ExpressionMammalianAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMP472
Plasmid#134997PurposeInterspersed Reporter. Fluorescent reporter to be used with m6A readers and writers. (8xZF binding sites + 14xGATC sites)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donorDepositorInsertInters. (8XZFBS 14XGATC)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donor
UseAAV and Synthetic BiologyExpressionMammalianAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP498
Plasmid#134998PurposeClustered Reporter. Fluorescent reporter to be used with m6A readers and writers. (5xZF binding sites + 63xGATC sites)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donorDepositorInsertClust. (5XZFBS 63XGATC)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donor
UseAAV and Synthetic BiologyExpressionMammalianAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP650
Plasmid#135000PurposeVP64-m6A Reader. Activates transcription near Gm6ATC sites. pUBC-DpnI(aa146-254)-VP64-V5 pGK-ZeoRDepositorInsertpUBC-DpnI(aa146-254)-VP64-V5 pGK-ZeoR
UseLentiviral and Synthetic BiologyTagsDpnI(aa146-254), V5 tag, and VP-64ExpressionMammalianMutationDpnI truncated to aa146-254Available SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBGN155-MXMT
Plasmid#79817PurposeGFP(S65T)-based BiFC vector for plants (Positive control: MXMT)DepositorInsertCaMXMT1
UseReporter plasmidTagsGN155/GFP (1ā155)ExpressionPlantPromoterCaMV 35S promoter and CaMV35SAvailable SinceAug. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0112
Plasmid#117548PurposeLevel 1 Golden Gate Cassette: xCas9 3.7 expression cassette for dicotyledonous plantsDepositorInsert2x35S+5'UTR OMEGA (pICH51288) + Sp-xCas9 3.7 (no stop codon) (pEPOR0SP0011) + YFP (pICSL50005) + Nos (pICH41421)
ExpressionPlantPromoter2x35S+5'UTR OMEGA (pICH51288)Available SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAGN33
Plasmid#131105PurposeAn integrative plasmid able to introduce a second copy of the pip gene in the chromosome of our conditional mutantsDepositorInsertP-furA102tetO-pip
ExpressionBacterialMutationthe furA102 promoter was mutated with the insertiā¦Available SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
GST eIF2beta
Plasmid#45900DepositorAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
psbA2(noATbox)-PHLS (c)
Plasmid#52308PurposeReplaces the psbA2 gene in Synechocystis with the PHLS geneDepositorInsertsbeta-phellandrene synthase
Chloramphenicol resistance
UseSynthetic BiologyExpressionBacterialMutationCAAATACA box in the psbA2 promoter to ggcgcgccPromoterpsbA2Available SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
cpc-PHLS (g)
Plasmid#52311PurposeReplaces the cpc operon in Synechocystis with the PHLS geneDepositorInsertsbeta-phellandrene synthase
Chloramphenicol resistance
UseSynthetic BiologyExpressionBacterialPromoterSynechocystis endogenous cpc-operon promoterAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBS-TRE-cofilin1(S3A)-P2A-mTurquoise2
Plasmid#163610PurposeExpresses constitutively active cofilin and mTurquoise2 under the TRE promoter in mammalian cellsDepositorAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-CC2
Plasmid#51221Purposeexpression of amino acid 917-1040 of chicken DCTN1 p150Glued in mammalian cellsDepositorAvailable SinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSP64R1 SHP2 WT
Plasmid#8325DepositorInsertSHP2 (PTPN11 Human)
UseXenopus expressionAvailable SinceJune 17, 2005AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-malG
Plasmid#89951PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting malG.DepositorInsertmalG gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo Cux2 in situ probe
Plasmid#45623DepositorInsertCux2 in situ probe (Cux2 Mouse)
UseIn situMutationfragment contains nt 1069-1694 on NM_007804Available SinceJune 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-hisG
Plasmid#89954PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting hisG.DepositorInserthisG gRNA
ExpressionBacterialPromoterpTetAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-Flex-rev-GFPFANACfullWT
Plasmid#126551PurposeAAV Flex reverse plasmid with the coding sequence of eGFP fused to the N-term of the FMRFamide gated Na channelDepositorInserteGFP N-terminal fused to FMRFamide gate sodium channel
UseAAVAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
HOXC13(human) GSTfusion-pET
Plasmid#8680DepositorInsertHOXC13 (HOXC13 Human)
TagsGSTExpressionBacterialMutationmakes protein by Coomassie blue stainingAvailable SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pJAF210
Plasmid#52406PurposeExpresses Flag-tagged mouse Arf5DepositorAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only