We narrowed to 1,583 results for: cag promoter
-
Plasmid#87836PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive expression of an sgRNA targeting human RB1.DepositorInsertsgRB1 (RB1 Human)
UseCRISPR and Lentiviral; Doxycycline inducible; egf…ExpressionMammalianPromoterTight TRE promoter and U6Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa human
Plasmid#224578PurposeTo stably downregulate the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA3
Plasmid#136458PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Empty Bridge Control Zfp462-Klf4SE
Plasmid#127666PurposeEncodes for 4 gRNAs expressed from their individual hU6 promoters. Two gRNAs target the Zfp462 promoter while the other two target the Klf4 stretch enhancer.DepositorInsertgRNAs 129, 135, 115, 117
UseCRISPRExpressionMammalianPromoterhU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-iRFP670-P2A-puro
Plasmid#208399Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, iRFP670 fluorescent protein and puromycin resistanceDepositorArticleInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-Crimson-P2A-puro
Plasmid#208398Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, E2-Crimson fluorescent protein and puromycin resistanceDepositorArticleInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsE2-CrimsonExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-mNeonGreen-P2A-puro
Plasmid#208400Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, mNeonGreen fluorescent protein and puromycin resistanceDepositorArticleInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsmNeonGreenExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-SDHB_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172670PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human SDHB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertSDHB pegRNA and SDHB_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-ALDOB_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172668PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human ALDOB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertALDOB pegRNA and ALDOB_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
1197R_gZBF-ER
Plasmid#241825PurposegRNA expressing plasmid with broken SEPARATORDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMADM-alpha
Plasmid#36890DepositorInsertsGFP
tdTomato-3Myc
beta-globin intron
Neo
ATG (T)
GFP
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, deleted…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pPN282
Plasmid#91665PurposeExpress sgRNA targeting human SDCCAG8DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hASCL1 gRNA_multi1-3-MS2-Puro
Plasmid#192682PurposeLentiviral expression of multi gRNAs targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNAs #1,2,3 (ASCL1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ADAR2-2a-Fezf2 sesRNA-2a-tTA2-WPRE
Plasmid#239027PurposeExpression of ADAR2, sesRNA in mammalian cells with hSyn promoter, with tTA2 as efRNA and ADAR2 overexpression.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgAAVS1
Plasmid#184403PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1-specific sgRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-42:AAVS1-mTagRFPT-CAAX
Plasmid#107580PurposeHomology arms, promoter and linker-mTagRFPT-CAAX sequence for internal insertion of CAGGS-driven mTagRFPT-CAAX at the AAVS1 safe harbor location in human cellsDepositorInsertAAVS1 Homology Arms with CAGGS-driven mTagRFPT-CAAX (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMay 9, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO.1 puro shSLC2A1-2
Plasmid#193703PurposeConstitutive lentiviral expression of SLC2A1 shRNADepositorInsertSLC2A1 (SLC2A1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCas9-sgCh2-2-Blast
Plasmid#199645PurposeExpresses Cas9 and sgRNA control guide targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only