We narrowed to 30,805 results for: des.2
-
Plasmid#85978PurposeExpresses DD-SpCas9 in mammalian cells and targets the H11 locus in human cellsDepositorInsertDD-SpCas9
UseCRISPRTagsFKBP12 L106P DDExpressionMammalianAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmiRFP670-2-T2A-HO1
Plasmid#197250PurposeExpresses the protein of wmiRFP670-2-T2A-HO1 in neurons of C. elegansDepositorInsertwmiRFP670-2-T2A-HO1
ExpressionWormAvailable SinceOct. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-FOXM1-shRNA-#2
Plasmid#89499PurposeLentiviral vector with dox inducible expression of shRNA targeting human FOXM1.DepositorInsertFOXM1 (FOXM1 Human)
UseLentiviral and RNAi; Doxycycline inducibleExpressionMammalianPromoterH1/TOAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro EGFP nLAP -2
Plasmid#194322PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(EGFP)
UseBacterial cloning vectorAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro EGFP nLAP +2
Plasmid#194307PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(EGFP)
UseBacterial cloning vectorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Myc-His(-)-MSulf-2
Plasmid#13008DepositorAvailable SinceOct. 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 Spike-d18
Plasmid#164583PurposeA mammalian expression vector to express codon-optimized SARS-CoV-2 Spike protein, with a C terminal truncation of 18 amino acids to improve pseudoparticle generation.DepositorInsertSARS-CoV-2 Spike (S SARS-CoV-2)
ExpressionMammalianMutationDeleted amino acids 1256-1273PromoterEF1aAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-SMG6-CDS-2
Plasmid#136047PurposeSMG6 shRNA (Targeting CDS #2) inserted into the PLKO.1 plasmid (AAGGAGTTCCAGGTGTTACTG)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ef1a-DIO-eGCaMP(2+)
Plasmid#201150PurposeAAV virus production for Cre recombinase dependent expression of eGCaMP(2+)DepositorInserteGCaMP_2+
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianAvailable SinceJune 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX6-2 SNAP-Syk tSH2
Plasmid#113028Purposefor purification of Syk tSh2. Purified protein will have a snap tag that can be conjugated to fluorescent dyes.DepositorInsertSNAP-Syk tSH2
TagsSNAPExpressionBacterialAvailable SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEBB HA BIR 2-3
Plasmid#25691DepositorAvailable SinceAug. 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-shNup133-2
Plasmid#87333PurposeTo express shRNA against human Nup133DepositorInsertshRNA against human Nup133
UseRNAiExpressionMammalianPromoterH1Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2-nMyc-m2_3'UTR
Plasmid#31860DepositorInsertnMyc mutant-1 3'UTR
UseLuciferaseTagsLuciferaseExpressionMammalianMutationSecond Let-7c Seed changed from TACCTC to TAACGCPromoterSV40Available SinceFeb. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
pdFLPtag-SA-SD-2-GFSTF
Plasmid#247951PurposeConditional tagging of endogenous proteins with GFSTF in open reading frame 2, with dual membrane labellingDepositorInsertGFSTF
TagsGFSTFExpressionInsectAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
p8390 LentiCRISPRv2 Neo sgNT-2
Plasmid#221650PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-2
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro BFP nLAP -2
Plasmid#194325PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(BFP)
UseBacterial cloning vectorAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro BFP nLAP +2
Plasmid#194319PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(BFP)
UseBacterial cloning vectorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPD187 Tri-AND Gate, 2 repeats
Plasmid#138940PurposeEYFP reporter vector for the Logic 37 AND 43 AND 158 2 repeats promoterDepositorInsertLogic 37 AND 43 AND 158 2 repeats
UseSynthetic BiologyExpressionMammalianPromoterLogic 37 AND 43 AND 158 2 repeatsAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2-nMyc-m1_3'UTR
Plasmid#31859DepositorInsertnMyc mutant-1 3'UTR
UseLuciferaseTagsLuciferaseExpressionMammalianMutationfirst Let-7c Seed changed from TACCTC to TAACGCPromoterSV40Available SinceSept. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBbS5a-Opto-Cre-Vvd-2
Plasmid#160400PurposeUpdated light-inducible Cre recombinase split with Vivid photodimers for bacterial expression.DepositorInsertOpto-Cre-Vvd-2
UseCre/Lox and Synthetic BiologyExpressionBacterialPromoterlacUV5Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only