We narrowed to 4,490 results for: GCA
-
Plasmid#102970PurposeSuppression of FXNDepositorInsertshFXN_1 (FXN Human)
UseLentiviral and RNAiAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shABCB7_2
Plasmid#102969PurposeSuppression of ABCB7DepositorInsertshABCB7_2 (ABCB7 Human)
UseLentiviral and RNAiAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shABCB7_1
Plasmid#102968PurposeSuppression of ABCB7DepositorInsertshABCB7_1 (ABCB7 Human)
UseLentiviral and RNAiAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgUFSP2
Plasmid#86134PurposeLentiviral vector expressing Cas9 and an sgRNA targeting UFSP2DepositorAvailable SinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAM/CBA-eGFP-miRNegativex3-WPRE-bGHpA
Plasmid#194249PurposeExpresses 3 non-targeting miRNAsDepositorInsertmiRNegative
UseAAV and RNAiPromoterCAGAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-ALDOB_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172668PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human ALDOB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertALDOB pegRNA and ALDOB_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TRIM25_G1
Plasmid#127119DepositorInsertgRNA TRIM25 (TRIM25 Human)
UseCRISPRAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
PTEN-mut (negative control)
Plasmid#86646Purposeexpression of control shRNADepositorInsertPTEN (control)
UseRNAiExpressionMammalianPromoterH1Available SinceJune 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBC-LG3-tdT
Plasmid#62810PurposepPBC-LG3-tdT expresses PiggyBac inverted terminal repeat-flanked Lck-GCaMP3 and tdTomato under the control of the CAG promoter.DepositorInsertITR-CAG-Lck-GCaMP3-IRES-tdTomato-ITR
ExpressionBacterial and MammalianPromoterCAGAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mU6-GFPGO-IRES-mScarletI
Plasmid#136895PurposeLentivirus for base editing activatable GFP expression in mammalian cells. All-in-one vector with sgGO2.DepositorInsertGFPGO-IRES-mScarletI
UseLentiviralTags3xNLS on mScarletMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2.sgNf1.1
Plasmid#91895PurposesgNf1.1 for Nf1 deletionDepositorInsertsgNf1.1
UseLentiviral and Mouse TargetingExpressionMammalianAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB3047(gRNA XII-1)
Plasmid#73289PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-1DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDP010
Plasmid#101166PurposeE. coli/S. cerevisiae amdS shuttle vector expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCrebbp#2/Cre
Plasmid#193210PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Crebbp geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_D
Plasmid#72623PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_A
Plasmid#72620PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 sgSp1
Plasmid#174907PurposeSecond generation sgRNA against Sp1DepositorInsertSpecificity Protein 1 (SP1 Human)
ExpressionMammalianMutationMissense mutation to mutate PAM sequencePromoterEFS-NSAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only